Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A kind of kit and identification method for five kinds of mandarin fish molecules

A technique of molecular identification and kit, which is applied in the molecular identification of five species of mandarin subfamily fish, kits and kits for five species of mandarin subfamily fish molecules, to achieve high detection accuracy, strong practicality, good repeatability

Inactive Publication Date: 2016-04-06
HUAZHONG AGRI UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The use of this kit can make up for the lack of morphological identification, solve the difficult problem of seed identification of three common cultured mandarin fish species in aquaculture (Sindarin mandarin fish, big-eyed mandarin fish and mandarin mandarin fish), and solve the problem of rare species of mandarin subfamily ( The identification of the species of Siniperca chinense and Siniperca chinensis in China, so as to promote the reasonable protection of Siniridae genetic resources and the healthy development of aquaculture industry

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of kit and identification method for five kinds of mandarin fish molecules
  • A kind of kit and identification method for five kinds of mandarin fish molecules
  • A kind of kit and identification method for five kinds of mandarin fish molecules

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] A kit for five species of Siniridae fish molecules, which includes three pairs of SSR primers and a standard map, wherein the sequences of the three pairs of primers used for polymerase chain reaction are respectively:

[0046] Primer 1 forward sequence: 5'TACATGCACACCAGTACGG3',

[0047] Primer 1 reverse sequence: 5'ACCCCGTTAAGTCCACGTC3';

[0048] Primer 2 forward sequence: 5'TAAGTGTACAAAGAACTTTTCGC3',

[0049] Primer 2 reverse sequence: 5'ACAATGTAAAAGTTTGGTTCAGC3';

[0050] Primer 3 forward sequence: 5'ATCAGCTCAACCCCTCTGCA3',

[0051] Primer 3 reverse sequence: 5'GCATGGATGCCAGCGTGA3';

[0052] The standard atlas used to identify the five species of Siniperidae is:

[0053] Schematic diagram of the microsatellite band spectrum of some species of Siniridae amplified by primer 1 ( figure 1 ), DNA bands of different sizes were amplified from the spotted mandarin fish and the Chinese scorpion mandarin fish described in the figure respectively with the other three manda...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a kit and an identification method for molecules of five Sinipercinae fishes. The kit comprises three pairs of SSR primers and standard maps. The identification method for molecules of five Sinipercinae fishes by using the kit comprises the following steps: 1) DNA extraction: a step of acquiring the fin ray or muscle tissue of a to-be-tested Siniperca chuatsi sample, extracting genome DNA and measuring the purity and concentration of the genome DNA; 2) DNA fragment amplification: a step of amplifying the genome DNA of the to-be-tested sample by using a polymerase chain reaction; 3) electrophoresis and silver staining identification of PCR products: a step of carrying out electrophoretic separation on the PCR products by using nondenaturing polyacrylamide gel, then carrying out staining by using a conventional silver staining method and taking photos to record electrophoresis results; and 4) comparison with the standard maps. The kit and the identification method provided by the invention can substantially improve efficiency and accuracy of identification of important economic and rare varieties of Sinipercinae and are beneficial for protection of genetic resources of Sinipercinae fishes and sustained sound development of the breeding industry of Siniperca chuatsi.

Description

technical field [0001] The invention belongs to the technical field of identification of natural germplasm resources of aquaculture fish species and aquatic animals, and specifically relates to a kit for molecules of five species of mandarin subfamily fish, and also relates to a kit for five species of mandarin subfamily Methods for the identification of fish molecules. Background technique [0002] Siniperidae belongs to the order Perciformes and is naturally distributed only in East Asia (Russia, Japan, Korea, China and Vietnam (Red River)). Among the subfamily Sinipercae, Sinipercachuatsi Basilewsky, Sinipercakneri Garman and Sinipercascherzeri Steindachner are the main rare and precious fishes cultured in my country. They have basically the same living habits and similar appearance characteristics. During the breeding process of the above three kinds of economic mandarin fish, the morphological identification cannot be made at the nursery stage. Especially, even at the ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68
CPCC12Q1/6858C12Q2531/113C12Q2525/151C12Q2565/125
Inventor 梁旭方田昌绪杨敏郑荷子赵程窦亚琪黄威
Owner HUAZHONG AGRI UNIV
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More