A kind of kit and identification method for five kinds of mandarin fish molecules
A technique of molecular identification and kit, which is applied in the molecular identification of five species of mandarin subfamily fish, kits and kits for five species of mandarin subfamily fish molecules, to achieve high detection accuracy, strong practicality, good repeatability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0045] A kit for five species of Siniridae fish molecules, which includes three pairs of SSR primers and a standard map, wherein the sequences of the three pairs of primers used for polymerase chain reaction are respectively:
[0046] Primer 1 forward sequence: 5'TACATGCACACCAGTACGG3',
[0047] Primer 1 reverse sequence: 5'ACCCCGTTAAGTCCACGTC3';
[0048] Primer 2 forward sequence: 5'TAAGTGTACAAAGAACTTTTCGC3',
[0049] Primer 2 reverse sequence: 5'ACAATGTAAAAGTTTGGTTCAGC3';
[0050] Primer 3 forward sequence: 5'ATCAGCTCAACCCCTCTGCA3',
[0051] Primer 3 reverse sequence: 5'GCATGGATGCCAGCGTGA3';
[0052] The standard atlas used to identify the five species of Siniperidae is:
[0053] Schematic diagram of the microsatellite band spectrum of some species of Siniridae amplified by primer 1 ( figure 1 ), DNA bands of different sizes were amplified from the spotted mandarin fish and the Chinese scorpion mandarin fish described in the figure respectively with the other three manda...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com