Breeding method capable of changing glume color of rice varieties with yellow glume to brownness
A technology of rice and chaff, applied in the field of rice biotechnology breeding, which can solve the problems of high cost, long breeding cycle, and insufficient focusing ability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0033] The test methods used in the following examples are conventional methods unless otherwise specified. The materials and reagents used in the following examples can be obtained from commercial sources unless otherwise specified.
[0034] Target Fragment Selection
[0035] Select the target fragment in the exon region of the rice glume color-determining gene OsCAD2 (LOC_Os02g09490.1), and one strand of the selected double-stranded target fragment must have a 5'-(N) X -NGG-3' structure, (N) X Represents a base sequence {N with number X 1 ,N 2 ...N x}, N 1 ,N 2 ...N x Each of them represents any one of A, G, C, T. N in NGG is any one of A, G, C, T. On the exon of the OsCAD2 gene, with the (N) X -There are 96 fragments of NGG-3' structure that can be selected as targets.
[0036] In this example, the nucleotide sequence CCGCCGAGAAGACCGTCACC at positions 14-36 after the translation initiation codon ATG on the first exon of the rice OsCAD2 gene (LOC_Os02g09490.1) w...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com