Primer and method for detecting leukemia BCR/ABL b3a2 and b2a2 fusion gene relative transcript level
A relative expression level and fusion gene technology, which is applied in the field of primers and methods for detecting the relative expression level of leukemia BCR/ABL b3a2, b2a2 fusion genes, can solve the problems of high cost and poor specificity, and achieve simple operation and low detection cost , the effect of high detection accuracy
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0026] The kit for detecting the relative expression of leukemia BCR / ABL (b3a2, b2a2) fusion gene of the present invention comprises:
[0027] Red blood cell lysate;
[0028] TRIzol;
[0029] Chloroform;
[0031] ReverTra Ace qPCR RT Kit (TOYOBO);
[0032] Detection system PCR reaction solution: THUNDERBIRD Probe qPCR Mix (2×), b3a2 / b2a2 upstream and downstream primers 0.8uM, b3a2 / b2a2-probe (probe) 0.4uM; abl upstream and downstream primers 0.8uM, abl-probe (probe) 0.4uM; where:
[0033] b3a2-F:GATTTAAGCAGAGTTCA;
[0034] b2a2-F:TGTGTGAAACTCCAGACTGT;
[0035] b3a2 / b2a2-R:TCCTTGGAGTTCCAACGA;
[0036] b3a2 / b2a2-Probe:FAM-AGCCCTTCAGCGGCCAGTAGCATCT-TAMRA;
[0037] abl-F:GCCGTGAAGACCTTGAAGGAG;
[0038] abl-R:ATGATATAGAACGGGGGCTC;
[0039] abl-Probe:FAM-ACCTGGTGCAGCTCCTTGGG-TAMRA
[0040] Positive control substance: respectively containing BCR / ABL (b3a2, b2a2) genome solution;
[0041] Negative control: Genomic solution without BCR / ABL (b3a2,...
Embodiment 2
[0043] The using method of kit of the present invention:
[0044] (1) Extract tissue RNA from blood: Add 1ml of erythrocyte lysate to a clean 1.5ml centrifuge tube, take 0.5ml of anticoagulated blood and mix well. Let stand at room temperature for 10 minutes; centrifuge at 5000rpm for 5min, discard the supernatant, and collect the cells at the bottom; add 0.5ml red blood cell lysate again, centrifuge at 5000rpm for 5min, discard the supernatant, and collect the cells at the bottom; add 1ml TRIzol to the cells, and pipette repeatedly until sedimentation Dissolve completely, let stand at room temperature for 5 minutes; add 0.2ml chloroform, shake evenly; centrifuge at 14000rpm at 4°C for 10 minutes, absorb the supernatant layer and transfer to another new centrifuge tube; add an equal volume of isopropanol, mix well up and down, and let stand at room temperature Centrifuge at 14000rpm at 4°C for 10min, discard the supernatant, add 1ml of 75% ethanol, wash the tube wall upside down...
Embodiment 3
[0054] Using the nucleic acid detection kit of the present invention to detect clinical specimens
[0055] Take 20 cases of anticoagulant blood samples from patients with chronic myeloid leukemia (CML), acute lymphoblastic leukemia (ALL) and a small number of patients with acute myeloid leukemia (AML), extract genomic RNA and prepare reagents according to the method described in Example 2 and detect.
[0056] Add 2ul of each sample to the detection system PCR reaction solution. At the same time, make a standard curve of positive, negative, blank control, and internal reference gene / target gene. A 96-well fluorescent PCR instrument can detect 38 samples at the same time, each sample has 2 repetitions, a positive control, a negative control and a blank control. The detection time is only 100 minutes.
[0057] The experimental results are compared with the results reported by the special inspection laboratory to determine the accuracy of the sample detection. Some positive re...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com