A dsrna inhibiting the expression of wheat aphid gland protein mys2 gene and its application
A gland and protein technology, applied in the field of dsRNA, can solve problems such as the decline of target gene expression
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0021] Example 1. Preparation of dsRNA for silencing glandular protein MYS2 gene
[0022] 1. Extract the total RNA of Aphid rubella and reverse transcribe it into cDNA.
[0023] 2. Using the cDNA obtained in step 1 as a template, perform PCR amplification with a primer pair composed of P1-F and P1-R to obtain a PCR amplification product. The agarose gel electrophoresis of the PCR amplification product is shown in figure 1 a.
[0024] P1-F (upstream primer): TAATACGACTCACTATAGGG AGGTTTGGATCGAGTGCTGGTCTAAAATGC;
[0025] P1-R (downstream primer): TAATACGACTCACTATAGGG AGGACCGCCGAAGACTTCAACGA.
[0026] The underlined region is the T7 promoter sequence.
[0027] PCR reaction system: 10×PCRBuffer 5μL, dNTP (2.5mmol L -1 ) 4 μL, rTaq 0.5 μL, upstream primer (20 μmol L -1 ) 1 μL, downstream primer (20 μmol L -1 ) 1 μL, template 1 μL, with ddH 2 O to make up to 50 μL.
[0028] PCR reaction conditions: 94°C for 4min; 39 cycles of 94°C for 30s, 55°C for 30s, and 72°C for 30s; ...
Embodiment 2
[0032] Embodiment 2, preparation of dsRNA for silencing GFP gene
[0033] 1. Synthesize the double-stranded DNA molecule shown in sequence 3 of the sequence listing.
[0034] 2. Using the double-stranded DNA molecule obtained in step 1 as a template, carry out PCR amplification with a primer pair composed of P4-F and P4-R to obtain a PCR amplification product. The agarose gel electrophoresis of the PCR amplification product is shown in figure 1 b.
[0035] P4-F (upstream primer): TAATACGACTCACTATAGGG ACGGGAACTACAAGACACG;
[0036] P4-R (downstream primer): TAATACGACTCACTATAGGG CTTTGGAAAGGGCAGATT.
[0037] The PCR reaction system and PCR reaction conditions are the same as those in Step 2 of Example 1.
[0038] 3. Preparation of dsRNA-2
[0039] The PCR amplification product obtained in step 2 was recovered and used as a template, and the T7 in vitro transcription kit was used for in vitro transcription (incubated at 42°C for 16 hours), and the residual template DNA and si...
Embodiment 3
[0041] Embodiment 3, the application of dsRNA in inhibiting the growth of aphids
[0042] 1. Preparation of artificial diet for aphids and preparation of feeder
[0043] For the artificial feed preparation method and the structure of the incubator, please refer to the reference (Li Caixia, Gao Lifeng, Gao Lingling, Li Runzhi. Research on raising aphids in pure artificial nutrient solution. Journal of Shanxi Agricultural University, 1997, 17(3): 225-228.LiCX . Filter the artificial feed with a bacterial filter with a pore size of 0.2 μm, dispense it into 2.0 mL sterilized centrifuge tubes, and store it in a -20°C refrigerator to avoid repeated freezing and thawing.
[0044] 2. Application of dsRNA in inhibiting the growth of aphids
[0045] See references for feeding methods of Aphid aphids: Jiao Min, Liu Shusheng. Techniques for feeding aphids with artificial diet. Acta Entomological Sinica East China, 2004, 13(2): 102-109. JiuM, LiuSS. Aphidrearing with artificial diets. En...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com