Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Kit for detecting common mutations of CYP4V2 gene

A technology of kits and reagents, applied in the field of kits for detecting common mutations of the BCD pathogenic gene CYP4V2 gene, can solve problems such as lack of

Inactive Publication Date: 2013-12-25
ARMY MEDICAL UNIV
View PDF2 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

BCD is less common in European and American countries, but more common in China and Japan. At present, there is still a lack of industrialized and standardized fetal or newborn BCD genetic screening technology, making it difficult to make early diagnosis of BCD children

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit for detecting common mutations of CYP4V2 gene
  • Kit for detecting common mutations of CYP4V2 gene
  • Kit for detecting common mutations of CYP4V2 gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] Example 1 Genomic DNA Extraction

[0050] Genomic DNA in venous blood was extracted using a spin-column blood genomic DNA extraction kit (TIANamp Blood DNA Kit) produced by Beijing Tiangen Company. The reagent composition is shown in Table 2.

[0051] Table 2 Kit Components

[0052] Reagent name

[0053] Rinsing solution PW

[0054] The steps of extracting whole genome DNA in venous blood are as follows:

[0055] 1. Take 200ul of blood sample into a 1.5ml sterile centrifuge tube, add 20ul of proteinase K solution, and mix well.

[0056] 2. Add 200ul buffer solution GB, fully invert and mix well, bathe in 56 degree water for 10min, during which invert several times.

[0057] 3. Add 200ul of absolute ethanol and mix thoroughly by inversion.

[0058] 4. Put the solution obtained in the previous step into the adsorption column CB3 (put CB3 into the collection tube first), centrifuge at 12000 rpm for 30 sec, discard the waste liquid, and put CB3 into ...

Embodiment 2

[0068] Example 2 PCR amplification target gene fragment

[0069] 1. Primer sequence

[0070] Specific PCR amplification primers were designed according to the target gene fragment, and the primer sequences are shown in Table 4.

[0071] Table 4 PCR primer sequences

[0072] Primer name

Primer sequence

CYP4V2-7 F1

AGCCTATGTTGTCGAAATGT

CYP4V2-7 F2

AAAAGCAAGTCAAAGAAAGGC

CYP4V2-8 F1

CACAGTGCAGTCATCAAATC

CYP4V2-8 F2

CCAAACATACCAAACACGTC

CYP4V2-9 F1

CTTTTTAGATGTCTGCACCC

CYP4V2-9 F2

AGCATACTTACCCCACTTCAC

[0073] Note: F1 is the forward primer; F2 is the reverse primer. See NG_007965.1 for the DNA sequence data of the CYP4V2 gene.

[0074] The primer pair CYP4V2-7 F1 and CYP4V2-7 F2 correspond to the detection of the mutation c.802-8_810del17insGC, and the product is the CYP4V2-7 gene with a size of 246bp; the primer pair CYP4V2-8 F1 and CYP4V2-8 F2 correspond to the detection of the mutation c.9...

Embodiment 3

[0091] Restriction enzyme digestion reaction of embodiment 3PCR reaction product

[0092] The PCR products obtained in Example 2, ie, CYP4V2-7, CYP4V2-8 and CYP4V2-9, were digested with restriction enzymes respectively, and the restriction enzymes used were CdiI, ApaI and CdiI respectively. The PCR product CYP4V2-7 gene corresponds to the detected mutation c.802-8_810del17insGC, the CYP4V2-8 gene corresponds to the detected mutation c.992A>C, and the CYP4V2-9 gene corresponds to the detected mutation c.1091-2A>G. The base sequence recognized by the restriction endonuclease CdiI is CATCG, and the base sequence recognized by ApaI is GGGCCC. A change in any base in the recognition sequence will result in the recognition of the restriction endonuclease. The restriction endonuclease digestion reaction system was established as shown in Table 6.

[0093] Table 6 restriction endonuclease digestion reaction system

[0094] ingredients

Volume (ul)

Buffer (10×)

...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of gene detection,in particular to a kit used for detecting mutations of a CYP4V2 virulence gene of BCD,The kit can rapidly, economically and accurately judge gene types of a c.802-8_810del17insGC mutation site, a c.992A>C mutation site and a c.1091-2A>mutation site, through the joint detection on the three high-frequency mutation sites of the CYP4V2 gene, early-stage definite diagnosis, early-stage warning and early-stage intervention can be carried out on a BCD carrier and a BCD patient, and the early-stage warning time of BCD related to the three high-frequency excludability mutations of the CYP4V2 gene can be brought forward to a foetal period, so that a BCD child gets early-stage treatment, and the kit is beneficial to BCD good birth and good care and improving the prevention and cure level of the BCD; the detection method provides the basis for diagnosis and treatment of the BCD patient and the BCD carrier.

Description

technical field [0001] The invention relates to the field of gene detection, in particular to a kit for detecting common mutations of the BCD pathogenic gene CYP4V2 gene and application thereof. Background technique [0002] Crystalline retinitis pigmentosa (Bietti crystalline corneoretinal dystrophy, BCD) is a retinal degenerative change characterized by scattered distribution of crystal-like small flashes in the fundus, and may also have choroidal vascular sclerosis, progressive night blindness and reduced visual field. Crystalline retinal degeneration was first reported by Bietti in 1937, also known as Bietti's crystalline dystrophy. The age of onset of BCD is generally between 20 and 40 years old. The lesions in both eyes are roughly symmetrical and develop synchronously. Afterwards, progressive vision loss occurs. Some patients may become completely blind when they are 50 to 60 years old. The disease is more common in my country and Japan, and less common in European a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68
Inventor 郭洪孟晓红白云
Owner ARMY MEDICAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com