Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Primer pair and reagent kit for detecting coccinella septempunctata, and detection method thereof

A technology of seven-spot ladybug and primer pair, which is applied in biochemical equipment and methods, microbe determination/inspection, DNA/RNA fragments, etc., can solve the problem of no detection method for seven-spot ladybug, and achieve rapid sensitivity and high sensitivity , the effect of high sensitivity

Inactive Publication Date: 2013-12-11
INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In addition, predation within the group is common among different ladybugs, but conventional methods such as intestinal anatomy and behavioral observation cannot accurately assess this important predation relationship
Therefore, in order to better identify ladybug species and study the predation of ladybugs within the group, it is necessary to establish a set of rapid and accurate molecular detection methods, but there is no standard detection method for seven-star ladybugs.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer pair and reagent kit for detecting coccinella septempunctata, and detection method thereof
  • Primer pair and reagent kit for detecting coccinella septempunctata, and detection method thereof
  • Primer pair and reagent kit for detecting coccinella septempunctata, and detection method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Embodiment 1 detection primer CsF6 / R6 is to the amplification effect of seven-star ladybug

[0024] (1) Preparation of ladybug template DNA

[0025] Put the single-headed ladybug into a 1.5ml centrifuge tube and grind it, and use the TIANamp Genomic DNA Kit Blood / Cell / Tissue Genomic DNA Extraction Kit (Spin Column Type) (Tiangen Bio (Beijing) Co., Ltd.) to extract the single-headed ladybug The ladybug genome.

[0026] (2) Synthesize and test the specific COI primers of Ladybug

[0027] The primer pair of the present invention is designed by comparing the gene sequences of different ladybug mitochondrial cytochrome oxidase I subunits (cytochrome oxidase subunit I, COI) amplified by the universal primer pair LepF1 (ATTCAACCAATCATAAAGATATTGG) and LepR1 (TAAACTTCTGGATGTCCAAAAAATCA).

[0028] Design the specific COI primer pair for testing the seven-star ladybug:

[0029] Primer CsF6:5'-AATATACGACCATTTGGC-3'

[0030] Primer CsR6:5'-TTGATAAAGGATGGGATCT-3'

[0031] (3) Pe...

Embodiment 2

[0043] Example 2 Primer CsF6 / CsR6 Determination of the Minimum Detection Amount of Coccinella chinensis

[0044] (1) Preparation of template DNA of Ladybug seven-star ladybug

[0045] According to Example 1, the genomic DNA of a single ladybird adult beetle was extracted. Then the original template solution was serially diluted by 2 times until no bands could be detected, and 1 μL was used as the template for PCR amplification, which was directly added to the PCR reaction system.

[0046] (2) Synthesize and test the specific COI primers of Ladybug, the nucleotide sequences of which are the same as those in Example 1.

[0047] (3) Perform PCR amplification reaction, the reaction system and PCR amplification procedure are the same as in Example 1.

[0048] (4) To identify the PCR product, the identification method is the same as in Example 1.

[0049] (5) Implementation Results

[0050] Use the primer CsF6 / CsR6 to determine the minimum detection amount, and use the seven-spo...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a primer pair for detecting coccinella septempunctata. The primer pair sequence is shown as SEQ ID No.1 and SEQ ID No.2. The invention also relates to a reagent kit containing the primer pair and a detecting method for detecting coccinella septempunctata by virtue of the primer pair and the reagent kit. The detecting method is simple, fast, peculiar and sensitive.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a pair of primers, a kit and a detection method for detecting ladybugs. Background technique [0002] The seven-star ladybug Coccinella septempunctata L. is a predatory natural enemy insect of the Coccinoptera family Coccinoptera. Adults and larvae can prey on wheat aphids, cotton aphids, flowering aphids, green peach aphids, scale insects, ticks and other pests. And various crops are damaged by pests, which are called "live pesticides". Except in winter, there is a chance to find adult seven-spot ladybugs foraging in places where aphids occur outdoors, but they seldom gather in groups. There are multiple generations in a year, and adults live through the winter, emerge in April of the following year, and lay eggs on plants with aphids. Wide distribution, in China (Beijing, Hebei, Heilongjiang, Jilin, Henan, Shaanxi, Gansu, Xinjiang, Tibet, Yunnan, Guizhou, Sichuan, Hubei, Hunan, Z...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11
Inventor 杨帆王倩陆宴辉徐建祥
Owner INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com