Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Taqman Real-time RT-PCR (reverse transcription-polymerase chain reaction) kit for detecting PRRSV (porcine reproductive and respiratory syndrome virus)

A kit, the technology of pmd-228, is used in the determination/inspection of microorganisms, fluorescence/phosphorescence, biochemical equipment and methods, etc. The effect of detecting, avoiding infection, preventing contamination

Inactive Publication Date: 2013-09-18
LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The technical problem to be solved in the present invention is to overcome the prior art that cannot adapt to accurate, fast and sensitive detection requirements, thereby providing a Taqman Real-time RT-PCR kit that can detect PRRSV quickly, sensitively and accurately. The present invention also Provide the method of using the kit

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Taqman Real-time RT-PCR (reverse transcription-polymerase chain reaction) kit for detecting PRRSV (porcine reproductive and respiratory syndrome virus)

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] 1. Design and preparation of primers

[0029] Refer to GenBank (gene bank) to find ten strains, find the conserved regions on each sequence through sequence comparison, select the conserved regions and design a pair of amplification primers and a probe primer, the sequence is as follows:

[0030] The amplification primer sequences are:

[0031] SEQ ID NO: 1: Upstream primer CCCGGGTTGAAAAGCCTCGTGT,

[0032] SEQ ID NO: 2: Downstream primer GGCTTCTCCGGGTTTTTCTTCCTA.

[0033] The probe primer sequence is:

[0034] SEQ ID NO: 3: TGGCAGAAAAGCTGTTAAAGCAGGGAGTGGT.

[0035] The above primers were synthesized and labeled by Dalian Bao Biological Engineering Co., Ltd.

[0036] Positive control: The positive control of the kit of the present invention was constructed and preserved by the Lanzhou Veterinary Research Institute of the Chinese Academy of Agricultural Sciences.

[0037] 2. Prepare the kit

[0038] This kit consists of the following components:

[0039] a. 2×One S...

Embodiment 2

[0052] Step 1-2 is the same as embodiment 1

[0053] 3. The method for detecting porcine reproductive and respiratory syndrome virus with the kit of the present invention

[0054] (1) The total PCR system is 25 μl, respectively a. 2×One Step RT-PCR bufferIII: 12.5 μL; b. Ex Taq HS: 0.5 μL; c. PrimerScript RT Enzyme Mix II: 0.5 μL; d. A total of 3 μl of three primers; f. 6.5 μl of RNase-free water, added to a 0.2 ml amplification tube;

[0055] (2) Add 3 μl of positive control, 3 μl of RNA template extracted from whole blood of pigs to be tested, and 3 μl of negative control to the above-mentioned amplification tube, centrifuge at 12000rpm for 5-30 seconds, and put the amplification tube into the amplification instrument In the process, amplification was performed under the following setting procedures: reverse transcription at 42°C for 5 min; pre-denaturation at 94°C for 2 min; 94°C for 20 s, annealing temperature at 57°C for 30 s, and 72°C for 20 s, 40 cycles. Directly obse...

Embodiment 3

[0059] Step 1-2 is the same as embodiment 1

[0060] 3. The method for detecting porcine reproductive and respiratory syndrome virus with the kit of the present invention

[0061] (1) The total PCR system is 25 μl. In the kit of the present invention, a. 2×One Step RT-PCR bufferIII: 12.5 μL; b. Ex Taq HS: 0.5 μL; c. PrimerScript RT Enzyme Mix II: 0.5 μL; d. a total of 3 μl of three primers; f . 6.5 μl of RNase-free water was added to the 0.2 ml amplification tube;

[0062] (2) Add 3 μl of positive control, 3 μl of RNA template extracted from pig serum to be tested, and 3 μl of negative control to the above-mentioned amplification tubes, centrifuge at 12000 rpm for 5-30 seconds, and put the amplification tubes into the amplification instrument , Amplified under the following setting program: reverse transcription at 42°C for 5 minutes; pre-denaturation at 94°C for 2 minutes; 94°C for 20 s, annealing temperature at 57°C for 30 s, 72°C for 20 s, 40 cycles. Directly observe the...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a Taqman Real-time RT-PCR (reverse transcription-polymerase chain reaction) kit for detecting a PRRSV (porcine reproductive and respiratory syndrome virus). The kit comprises an One Step RT-PCR buffer III, Ex Taq HS, a PrimerScript RT Enzyme Mix II, a negative control, a positive control and a mixture of amplification primers SEQ ID NO:1 to SEQ ID NO:2 and a probe primer SEQ ID NO:3. According to the kit, reverse transcription and PCR amplification processes are finished in a one-step reaction, so that the detection time is shortened, a reaction detection result can be directly seen without electrophoresis, and a quick detection is facilitated; and meanwhile, the pollution of reaction products can be effectively prevented through a closed tube operation. A probe method is used in the kit, so that an effective effect can be generated only when a probe is specifically combined on an amplification target sequence, the accuracy is high, and the prevention and control of the PRRSV and the removal of recessive poisoned animals are promoted.

Description

technical field [0001] The present invention relates to porcine reproductive and respiratory syndrome virus prevention technical field, specifically a kind of Taqman Real-time RT-PCR (probe method real-time quantitative reverse transcription- Polymerase chain reaction) kit, the present invention also includes the use method of this kit. Background technique [0002] Porcine reproductive and respiratory syndrome (Porcine reproductive and respiratory syndrome, PRRS), also known as blue ear disease, is a new highly contagious pig disease, mainly manifested as early abortion, stillbirth, mummified fetus, and Reproductive disorders such as weak piglets, respiratory symptoms in pigs of all ages, high piglet mortality, and immunosuppression in infected pigs. At present, as far as the detection methods of porcine reproductive and respiratory syndrome virus are concerned, there are compound RT-PCR (reverse transcription-polymerase chain reaction) methods and ordinary RT-PCR methods,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/70C12Q1/68G01N21/64
Inventor 刘湘涛田宏吴锦艳陈妍尚佑军尹双辉王光祥张克山杨顺利刘永杰宋江伟
Owner LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com