Supercharge Your Innovation With Domain-Expert AI Agents!

Method for detecting cattle Vaspin gene single nucleotide polymorphism and application of method

A single nucleotide polymorphism, scalper technology, applied in the field of molecular genetics

Inactive Publication Date: 2013-09-11
NORTHWEST A & F UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There is no research on the genetic variation of Vaspin gene in animals at home and abroad

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for detecting cattle Vaspin gene single nucleotide polymorphism and application of method
  • Method for detecting cattle Vaspin gene single nucleotide polymorphism and application of method
  • Method for detecting cattle Vaspin gene single nucleotide polymorphism and application of method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0030] The present invention uses the PCR-RFLP method to detect the single nucleotide polymorphism that may result in a change in the composition of the encoded protein due to the mutation of the synonymous codon at site 1124477 of the cattle Vaspin gene. The present invention will be further described in detail in conjunction with the following. They are presented by way of explanation, not limitation, of the invention.

[0031] a, the design of PCR primers in the second exon region of the cattle Vaspin gene

[0032] Taking the bovine (NW_001494061) sequence published by NCBI as a reference, Primer5.0 was used to design PCR primers capable of amplifying the region of the ninth exon of the cattle Vaspin gene. The primer sequences are as follows:

[0033] Upstream primer: TGTTATTGTCAGGGCTGCT19;

[0034] Downstream primer: GGCTTAGAGTATGTTGGCAT20.

[0035] Using the above primers to amplify the cattle genome, a 463bp gene fragment containing the second exon region of the cattle V...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for detecting cattle Vaspin gene single nucleotide polymorphism and application of the method. The method comprises the following steps of: carrying out PCR (Polymerase Chain Reaction) amplification on the Vaspin gene by using to-be-detected cattle whole genome DNA as a template and using a primer pair P as a primer; carrying out polyacrylamide gel electrophoresis on digested amplified fragments after digesting the PCR amplified products by using restriction enzyme MspI; and identifying the single nucleotide polymorphism of the 1124477th site of the cattle Vaspin gene according to the polyacrylamide gel electrophoresis result. The Vaspin gene functionality involves growth characteristics of birth weight, daily gain and body weight, the detecting method provided by the invention can be used for laying up a foundation for establishing a relationship between SNP (Single Nucleotide Polymorphism) of the Vaspin gene and growth characteristics, so as to be convenient for marker assisted selection (MAS) of the growth characteristics for Chinese cattle, and therefore, an excellent cattle population with excellent genetic resources is quickly established.

Description

technical field [0001] The invention belongs to the field of molecular genetics and relates to the detection of gene single nucleotide polymorphism (SNP), in particular to a method and application for detecting the single nucleotide polymorphism of cattle Vaspin gene. Background technique [0002] Single nucleotide polymorphism (SNP) refers to the polymorphism caused by the substitution of a single nucleotide (A / T / C / G) in the genomic DNA sequence. Therefore, commonly referred to as SNPs include base substitutions, insertions, deletions, and changes in the copy number of repeated sequences. A SNP indicates that there is a nucleotide change at a certain position in the genome, which is mainly caused by the conversion or transversion of a single base; SNPs with conversion mutations account for about 2 / 3, and other SNPs are in similar level. The cytosine of the CpG dinucleotide is the most mutated site in the genome, most of which are methylated and can be spontaneously deamin...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68
Inventor 陈宏赖新生张晨歌王璟王辰蓝贤勇胡沈荣雷初朝
Owner NORTHWEST A & F UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More