DNA electrochemical sensor based on self-enhanced amplified signal of target DNA repeats
A DNA repetition and signal amplification technology, applied in the field of biosensing, can solve the problems of weak current signal, inability to catalyze TMB oxidation, and inability to form, so as to achieve the effect of improving sensitivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0047] The preparation steps of the DNA electrochemical sensor based on the self-enhanced amplified electrical signal of the gene repeat sequence are as follows:
[0048] (1) Gold electrode in Piranha solution (30wt% H 2 o 2 Concentrated H with a concentration of 98wt% 2 SO 4 , mixed at a volume ratio of 1:3) at room temperature for 5 minutes, ultrasonically cleaned twice with deionized water, each time for 5 minutes, and then washed with 0.3 μm and 0.05 μm Al 2 o 3 and double-distilled water to polish to a mirror surface, followed by ultrasonic cleaning with ethanol and double-distilled water. Place the sonicated electrode at 0.5MH 2 SO 4 In the 0 ~ 1.6V potential range, cyclic voltammetry scan to stability, wash with double distilled water, N 2 Blow dry for later use;
[0049] (2) Immerse the bare gold electrode treated in step (1) in 0.1wt% BSA solution, assemble at room temperature for 15 minutes, wash with double distilled water, dry with nitrogen, take 4 μl captu...
Embodiment 2
[0051] The detection steps of the target DNA by the DNA electrochemical sensor based on the self-enhanced amplified electrical signal of the gene repeat sequence are as follows:
[0052] (1) Mix the signal probe DNA (5'-GTTTCCGTCCCTCTCTCGGGGTTTTGGGTCTGACGAC-Biotin-3') (oligonucleotide, synthesized by Baosheng Bioengineering Co., Ltd.) with the target DNA containing a repetitive sequence (5'-ACGGAAACCTTCAGCACCACCATCATCCGGCGCCTCAGCTCAGCATGTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC-3') In the hybridization buffer solution (by 10mmol / LNa 2 HPO 4 -NaH 2 PO 4 And 1mol / LNaCl preparation, and with H 3 PO 4 and NaOH to adjust the pH to 7.40, and the experimental water is double distilled water) to prepare a hybridization solution.
[0053] (2) The capture probe DNA immobilized on the electrode surface obtained in Example 1 (5'-CCGGATGATGGTGGTGCTGAAGGTTTCCGTT 10 -(CH 2 ) 6 -SH-3') and the hybridization solution obtained in step (1) were hybridized in a 44°C water bath for 60 minutes to...
Embodiment 3
[0057] The detection steps of the target DNA by the DNA electrochemical sensor based on the self-enhanced amplified electrical signal of the gene repeat sequence are as follows:
[0058] (1) Mix the signal probe DNA (5'-GTTTCCGTCCCTCTCTCGGGGTTTTGGGTCTGACGAC-Biotin-3') (50nmol / L oligonucleotide, synthesized by Baosheng Bioengineering Co., Ltd.) with the target DNA (5nmol / L, 5'-ACGGAAAACCTTCAGCACCACCATCATCCGGCGCCTCAGCTCAGCATGTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAACCCTTCGACGCCGGATTCGTGATCTCTTCCCGCGGATAGGTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC-3') in hybridization buffer solution (by 10mmol / LNa 2 HPO 4 -NaH 2 PO 4 And 1mol / LNaCl preparation, and with H 3 PO 4 and NaOH to adjust the pH to 7.40, and the experimental water is double distilled water) to prepare a hybridization solution.
[0059] (2) The capture probe DNA immobilized on the electrode surface obtained in Example 1 (5'-CCGGATGATGGTGGTGCTGAAGGTTTCCGTT 10 -(CH 2 ) 6 -SH-3') and the hybridization solution obtained in step (1...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap