Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Kit for detecting chlamydia trachomatis (CT)

A detection kit and a technology for Chlamydia trachomatis, which are applied in the determination/inspection of microorganisms, fluorescence/phosphorescence, biochemical equipment and methods, etc., can solve the problems of low detection sensitivity, achieve high detection sensitivity, wide detection range, and simple methods Effect

Active Publication Date: 2014-03-05
SANSURE BIOTECH INC
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0010] At present, kits for detecting CT-DNA based on real-time fluorescent quantitative PCR technology have been used in clinical detection at home and abroad, but most of these kits use the boiling method to extract nucleic acid, and the detection sensitivity is not high, about 500~1000copies / ml

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit for detecting chlamydia trachomatis (CT)
  • Kit for detecting chlamydia trachomatis (CT)
  • Kit for detecting chlamydia trachomatis (CT)

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] The present embodiment provides a specific Chlamydia trachomatis fluorescent PCR detection kit, which includes the following components:

[0027] ①Nucleic acid release agent: contains 0.1mM / L of surfactin, 100mM / L of potassium chloride, 0.1% of sodium dodecylsulfonate (SDS), and 0.1% of ethanol.

[0028] ②Internal standard (positive internal control): It is a recombinant of a 97 base pair artificially synthesized DNA sequence inserted into the pUC18T vector, that is, a plasmid, the concentration is 5.00E+05copies / ml, and the sequence of 97 base pairs is: 5'-GTGTCTGCGGCGTTTTATCATCATCTTCCTCTGTCATCCAGTGCAAGTCTTGATCCTGTCGTTGGTTCTTCTGGACTATCAAGGTATGTTGCCCGTTTGT-3'.

[0029] ③PCR reaction solution: including 5 μl of 10×PCR reaction buffer, 0.2 mmol / L dNTP, 0.3 μmol / L upstream and downstream primers for target polynucleotide amplification, and 0.3 μmol / L probe for target polynucleotide detection The upstream and downstream primers used for internal standard fragment amplifica...

Embodiment 2

[0034] This embodiment provides the operation steps of the kit described in the above-mentioned embodiment 1 for detecting CT-DNA in unknown samples such as genital secretions:

[0035] 1. Reagent preparation

[0036] According to the number of samples to be tested, CT negative control and CT positive control, take the corresponding amount of PCR reaction solution (38 μl / person), enzyme mixture (2 μl / person) and internal standard 1.0 μl / person in proportion, fully Mix well to form a PCR-mix. For example, when the samples to be tested are for 3 people, a total of 5 people should be prepared (the number of people for the above three is 3, 1, and 1 respectively) PCR-mix; centrifuge briefly and set aside.

[0037] 2. Sample processing

[0038] 1. Method A: Rapid nucleic acid release directly from the sample

[0039] Add 2-5 μl of nucleic acid release agent to each PCR reaction tube (deep aspiration and shallow pipetting are recommended to avoid air bubbles), add 3-5 μl each of t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a kit for detecting chlamydia trachomatis (CT). The kit comprises a nucleic acid releaser and a PCR (Polymerase Chain Reaction) solution, wherein the nucleic acid releaser comprises 0.01-0.5mM / L of surfactin, 20-300mM / L of potassium chloride, 0.01-2% of sodium dodecyl sulfate and 0.05-1% of ethanol; and the PCR solution comprises a forward primer and a reverse primer which are used for amplifying targeted polynucleotide, and a probe for detecting the targeted polynucleotide. A method of releasing nucleic acid by using the nucleic acid releaser in the kit provided by the invention is not obviously different from a boiling method in the detection result, and a violent protein denaturant adopted for the nucleic acid extraction in the method provided by the invention quickly breaks a coat protein structure of a pathogen to release pathogen nucleic acid, so the release and extraction of DNA (Deoxyribonucleic Acid) can be realized without heating; besides, the sensitivity of the provided kit for detecting the CT can be 400 copies / ml, the linearity region of the detection is 400-4.00E+10 copies / ml; and moreover, CT-DNA in an unknown sample such as genital secretions can be quickly and precisely detected by using the kit, so a reliable experiment basis is provided for diagnosing CT infection.

Description

technical field [0001] The invention provides a Chlamydia trachomatis (CT) detection kit, in particular a fluorescent PCR-based CT-DNA detection kit. Background technique [0002] Chlamydia trachomatis is a prokaryotic microorganism with a unique developmental cycle and strict intracellular parasitism. It is a special microorganism between viruses, bacteria and Rickettsia. It is one of the most common venereal pathogens at home and abroad, and the genital chlamydia infection ranks third among sexually transmitted diseases (STDs) in my country, and its incidence rate is increasing year by year. After the body is infected with CT, it can induce type-specific cellular immunity and humoral immunity, but usually the immunity is not strong and lasts for a short time, thus often causing persistent infection, recessive infection and repeated infection. [0003] One of the characteristics of Chlamydia trachomatis infection is that most of the infected patients have no obvious clinica...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68C12Q1/04G01N21/64
Inventor 戴立忠邓中平
Owner SANSURE BIOTECH INC
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More