LAMP (loop-mediated isothermal amplification) detecting kit for turkey trichomonas
A detection kit and technology for chicken histiomonas, applied in the biological field, can solve the problems of non-specific occurrence, detection time of at least 3 hours, time-consuming and laborious histopathological examination, cumbersome isolation and cultivation of parasites, etc., and saving instruments. Cost, high accuracy, fast cost effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0027] Make the loop-mediated isothermal amplification detection kit for Histomonas turkey according to the following formula:
[0028] (1) Reaction solution A:
[0029] Contains 10× isothermal reaction buffer, Bst DNA polymerase 8000U / mL, 10mM dNTP, 25mM MgCl 2 , 200 μM inner primer, 200 μM inner primer 2, 100 μM outer primer 1, 100 μM outer primer 2, 5M betaine and deionized water, wherein:
[0030] 10× isothermal reaction buffer containing 200 mM Tris-Hydroxymethylaminomethane hydrochloride (pH 8.8), 100 mM Potassium Chloride, 100 mM Ammonium Sulfate, 20 mM Magnesium Sulfate and 1% (m / V) Triton X-100 ( pH8.8, 25°C);
[0031] Internal primer 1 is: GAGCCCATGAACTATTGATTTCTCTAGTTCCTACCTTAAACTATGCC
[0032] Internal primer 2 is: CTACGACCGCAAGGCTGAAATTAAGCCACAAGCTCCAC
[0033] Outer primer 1 is: GTATCCAACCGGATCAGAG
[0034] The outer primer 2 is: AAGTTTCCCCCGTGTTGAT
[0035] (2) Reaction solution B: 1000× fluorescent dye SYBR Green I.
[0036] LAMP reaction solution A is 2...
Embodiment 2
[0038] Example 2: Detection of Histomonas turkey using LAMP Detection Kit for Histomonas turkey
[0039] Preparation of the treatment solution for the sample to be tested: Take the sample taken from chicken liver as an example, the diseased chicken liver was used as a positive sample, the normal chicken liver was used as a negative sample, and deionized water without samples was set up as a blank control.
[0040] A. Take 0.5g of liver tissue, add 1mL of cell lysis buffer (100mM pH8.0Tris, 500mM pH8.0EDTA, 20mM NaCL, 10%SDS), homogenize in a glass homogenizer until cloudy, and place the turbid solution at 1.5 mL centrifuge tube;
[0041] B. Add 20 μL of proteinase K (20mg / mL) and mix well, then bathe in a constant temperature water bath at 65°C for 30 minutes;
[0042] C. Centrifuge at 12000×g for 5min, take the supernatant into another centrifuge tube;
[0043] D. Add the same amount of phenol: chloroform: isoamyl alcohol (25:24:1), shake and mix well, centrifuge at 12000×g...
Embodiment 3
[0053] Example 3: Sensitivity test of the LAMP detection method for histomonas turkey
[0054] Take the plasmid DNA containing the specific gene of Histomonas turkey, and dilute it by 10 times as the template for the LAMP detection test, so that each μL of the dilution contains 10 copies of the template gene. 8 , 10 7 , 10 6 , 10 5 , 10 4 , 10 3 , 10 2 ,10,1;
[0055] Add 1 μL of the above genome diluent to the PCR reaction tube containing 24 μL of reaction solution A, and set a blank control without plasmid DNA at the same time, mix and centrifuge, drop 1 μL of reaction solution B in the middle of the inner side of the PCR tube cap, and cover tightly Place the tube cap in a constant temperature water bath at 60-65°C for 60 minutes;
[0056] Invert the PCR tube several times to fully mix the reaction mixture with reaction solution B. Observe the color of the reaction solution with the naked eye. The result shows that the reaction tube with plasmid DNA turns green, and t...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com