C829T single nucleotide polymorphism assay kit of DHFR
A single nucleotide polymorphism and detection kit technology, which is applied in the fields of life science and biology, can solve the problem of decreased function, and achieve the effects of low cost, guaranteed accuracy and sensitivity, and simple operation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0032] C829T single nucleotide polymorphism detection kit for detecting DHFR, including erythrocyte lysate, DNA extraction solution, PCR reagent, single strand purification reagent and sequencing reagent, of which:
[0033] (i) PCR amplification reagent: 2*PCR Buffer, 10mM dNTP, 5U / ul Taq enzyme, amplification primers (SEQ NO.1, SEQ NO. 2) and sterilized water; the sequences of SEQ NO1 and SEQ NO 2 are :
[0034] SEQ NO. 1: ACTAAGTGCTTCTCCAAGACC,
[0035] SEQ NO.2: Biotin-AATGTCAAGGACTGGCAAGAG;
[0036] (ii) Reagent for single-strand purification: streptavidin bead, 70% (V / V) ethanol, denaturing solution, 1×Wash Buffer, binding buffer, annealing buffer;
[0037] (iii) Sequencing reagents: DNA polymerase, ATP sulfurylase, luciferase, apyrase, substrate APS, fluorescein and dNTP (dNTP is dATP, dTTP, dCTP, dGTP) and sequencing primers (SEQ NO. 3). The sequence of SEQ NO.3 is: AGTCCCCAGCACCTG.
[0038] The using method of above-mentioned test kit comprises the following steps...
Embodiment 2
[0046] The concrete usage method of kit of the present invention:
[0047] 1. DNA extraction
[0048] 1) Take 300uL of blood and add 900uL of red blood cell lysate, mix by inversion, and let stand at room temperature for 5 minutes, during which time, invert and mix several times. Centrifuge at 10,000rpm for 1 minute (if the maximum speed of the centrifuge is not allowed, centrifuge at 3,000rpm for 5 minutes), absorb the supernatant, leave the white blood cell pellet, add 200uL buffer GA, shake until thoroughly mixed.
[0049] 2) Add 20 μl proteinase K solution, mix well, add 200 μl buffer GB, mix well by inverting, place at 70°C for 10 minutes, the solution should become clear, briefly centrifuge to remove water droplets on the inner wall of the tube cap.
[0050] 3) Add 200 μl absolute ethanol, vortex and mix well for 15 seconds, at this time flocculent sediment may appear, briefly centrifuge to remove water droplets on the inner wall of the tube cap.
[0051] 4) Put the so...
Embodiment 3
[0065] Clinical Sample Testing
[0066] The clinical samples A, B, and C to be tested were taken, and the genome was extracted, reagents were prepared and tested according to the method described in Example 2.
[0067] After the PCR product is purified, it is sequenced, and the obtained sequence is compared with the standard sequence to judge the result.
[0068] The sequencing results of sample A are shown in the figure figure 1 As shown, the sequencing result is: CTA C AGTGAG, the sample is CC type (wild type), and the red box in the figure is the judgment area of sample A genotype.
[0069] The sequencing results of sample B are shown in the figure figure 2 As shown, the sequencing result is: CTA C(T) AGTGAG, the sample is CT type (heterozygous type), and the red box in the figure is the judgment area of the sample B genotype.
[0070] The sequencing results of sample C are shown in the figure image 3 As shown, the sequencing result is: CTA T AGTGAG, the...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com