Primer, fluorescence probe and kit for quantitative detection of streptococcus pneumonia nucleic acid and detection method of streptococcus pneumonia nucleic acid
A Streptococcus nucleic acid, Streptococcus pneumoniae technology, applied in microorganism-based methods, biochemical equipment and methods, microbial determination/inspection, etc., can solve problems affecting the accuracy of experimental results, affecting the accuracy of identification, nucleic acid amplification Technical contamination and other problems, to prevent false negative and false positive results, improve specificity, and high sensitivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0049] Example 1. A primer and fluorescent probe for the quantitative detection of Streptococcus pneumoniae nucleic acid
[0050] (1) Design and synthesis of primers and fluorescent probes:
[0051] The specific conserved gene lytA gene of Streptococcus pneumoniae was selected as the target detection gene, and pneumoniae was obtained through the National Center for Biotechnology Information (NCBI) (http: / / www.ncbi.nlm.nih.gov) Streptococcus currently has 92 genotypes of Streptococcus pneumoniae lytA gene sequences, and online (http: / / www.ebi.ac.uk / ) to compare the lytA gene sequences of 92 genotypes, Select a conservative sequence in the gene region, which is shown in SEQ ID NO.4 in the sequence table: GCCTCAAGTCGGCGTGCAACCATAGGCA AGTACACGCACACTCAACTGGGAATCCGCATTCAACCGTACAGAATGAAGCGGATTATC ACTGGCGGAAAGACCCAGAATTAGGTTTTTTTCTCGCACATTGTTGGGAACGGTTGCATC AT, using real-time TaqMan 7 primers and fluorescent quantitative PCR professional design software BeaconDesigner The probe sequ...
Embodiment 2
[0065] Example 2. A kit for the quantitative detection of Streptococcus pneumoniae nucleic acid
[0066] The kit for the quantitative detection of Streptococcus pneumoniae nucleic acid prepared according to the technical scheme provided by the content of the present invention contains the following reagents:
[0067] 1. PCR reaction solution: The content ratio of each component of the PCR reaction solution is: 0.3 μL of Taq enzyme with a concentration of 5 U / μL; 2 μL of dNTPs with a concentration of 10 mmol / L; 5 μL of 10×PCR Buffer; MgCl 2 Solution 5 μ L; Concentration is 2.5 μ L of group A Streptococcus pneumoniae forward primer described in Example 1 of 10 μ mol / L; Concentration is 2.5 μ L of A group Streptococcus pneumoniae reverse primer of 10 μ mol / L; Streptococcus pneumoniae probe 2.5 μL; add sterile water to a volume of 49.5 μL. in:
[0068] Group A Streptococcus pneumoniae forward primer sequence is shown in SEQ ID NO.1 in the sequence listing:
[0069] 5'-AAGTCGG...
Embodiment 3
[0103] Example 3. Detection of Streptococcus pneumoniae nucleic acid in samples using the kit provided in this example
[0104] Among the reagents included in the kit provided in this example, except for the PCR reaction solution and DNA extraction solution as described below, the composition of the remaining negative quality control products, positive quality control products, critical positive quality control products, and working standards , proportioning and preparation method are the same as the kit described in Example 2:
[0105] (1) The ratio of the contents of each component of the PCR reaction solution is: 0.1 μL of Taq enzyme with a concentration of 5 U / μL; 1 μL of dNTPs with a concentration of 10 mmol / L; 5 μL of 10×PCR Buffer; and MgCl with a concentration of 25 mmol / L 2 Solution 3 μ L; Concentration is 0.25 μ L of Group A Streptococcus pneumoniae forward primer described in Example 1 of 10 μmol / L; Concentration is 0.25 μ L of Group A Streptococcus pneumoniae rever...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap