Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Primer, fluorescence probe and kit for quantitative detection of streptococcus pneumonia nucleic acid and detection method of streptococcus pneumonia nucleic acid

A Streptococcus nucleic acid, Streptococcus pneumoniae technology, applied in microorganism-based methods, biochemical equipment and methods, microbial determination/inspection, etc., can solve problems affecting the accuracy of experimental results, affecting the accuracy of identification, nucleic acid amplification Technical contamination and other problems, to prevent false negative and false positive results, improve specificity, and high sensitivity

Active Publication Date: 2013-01-16
WUHAN BIOTECH GENE ENG
View PDF3 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] However, there are still deficiencies in the above methods: using traditional culture methods (national standard method), latex agglutination method, immunochromatography and nucleic acid amplification technology detection, there will be false positive or false negative results, which will affect the accuracy of the experimental results Automated method Because the automatic identification system identifies bacteria according to the background information provided in the database, the incompleteness of the database information will directly affect the accuracy of identification, and there is currently no identification system that can include all detailed identification information; nucleic acid amplification Although the results of the amplification technology are better than the above four methods, the PCR amplification products need to be post-processed, and the contamination of the PCR products during the post-processing will still lead to false positive results, and will pollute the environment and have potential risks to the experimenters. Harm: Although real-time fluorescent quantitative PCR technology solves the problem of nucleic acid amplification technology pollution, and the detection results are more specific than nucleic acid amplification technology, it still cannot achieve 100% specificity

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer, fluorescence probe and kit for quantitative detection of streptococcus pneumonia nucleic acid and detection method of streptococcus pneumonia nucleic acid
  • Primer, fluorescence probe and kit for quantitative detection of streptococcus pneumonia nucleic acid and detection method of streptococcus pneumonia nucleic acid
  • Primer, fluorescence probe and kit for quantitative detection of streptococcus pneumonia nucleic acid and detection method of streptococcus pneumonia nucleic acid

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] Example 1. A primer and fluorescent probe for the quantitative detection of Streptococcus pneumoniae nucleic acid

[0050] (1) Design and synthesis of primers and fluorescent probes:

[0051] The specific conserved gene lytA gene of Streptococcus pneumoniae was selected as the target detection gene, and pneumoniae was obtained through the National Center for Biotechnology Information (NCBI) (http: / / www.ncbi.nlm.nih.gov) Streptococcus currently has 92 genotypes of Streptococcus pneumoniae lytA gene sequences, and online (http: / / www.ebi.ac.uk / ) to compare the lytA gene sequences of 92 genotypes, Select a conservative sequence in the gene region, which is shown in SEQ ID NO.4 in the sequence table: GCCTCAAGTCGGCGTGCAACCATAGGCA AGTACACGCACACTCAACTGGGAATCCGCATTCAACCGTACAGAATGAAGCGGATTATC ACTGGCGGAAAGACCCAGAATTAGGTTTTTTTCTCGCACATTGTTGGGAACGGTTGCATC AT, using real-time TaqMan 7 primers and fluorescent quantitative PCR professional design software BeaconDesigner The probe sequ...

Embodiment 2

[0065] Example 2. A kit for the quantitative detection of Streptococcus pneumoniae nucleic acid

[0066] The kit for the quantitative detection of Streptococcus pneumoniae nucleic acid prepared according to the technical scheme provided by the content of the present invention contains the following reagents:

[0067] 1. PCR reaction solution: The content ratio of each component of the PCR reaction solution is: 0.3 μL of Taq enzyme with a concentration of 5 U / μL; 2 μL of dNTPs with a concentration of 10 mmol / L; 5 μL of 10×PCR Buffer; MgCl 2 Solution 5 μ L; Concentration is 2.5 μ L of group A Streptococcus pneumoniae forward primer described in Example 1 of 10 μ mol / L; Concentration is 2.5 μ L of A group Streptococcus pneumoniae reverse primer of 10 μ mol / L; Streptococcus pneumoniae probe 2.5 μL; add sterile water to a volume of 49.5 μL. in:

[0068] Group A Streptococcus pneumoniae forward primer sequence is shown in SEQ ID NO.1 in the sequence listing:

[0069] 5'-AAGTCGG...

Embodiment 3

[0103] Example 3. Detection of Streptococcus pneumoniae nucleic acid in samples using the kit provided in this example

[0104] Among the reagents included in the kit provided in this example, except for the PCR reaction solution and DNA extraction solution as described below, the composition of the remaining negative quality control products, positive quality control products, critical positive quality control products, and working standards , proportioning and preparation method are the same as the kit described in Example 2:

[0105] (1) The ratio of the contents of each component of the PCR reaction solution is: 0.1 μL of Taq enzyme with a concentration of 5 U / μL; 1 μL of dNTPs with a concentration of 10 mmol / L; 5 μL of 10×PCR Buffer; and MgCl with a concentration of 25 mmol / L 2 Solution 3 μ L; Concentration is 0.25 μ L of Group A Streptococcus pneumoniae forward primer described in Example 1 of 10 μmol / L; Concentration is 0.25 μ L of Group A Streptococcus pneumoniae rever...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a primer, a fluorescence probe and a kit for the quantitative detection of streptococcus pneumonia nucleic acid and a detection method of streptococcus pneumonia nucleic acid, wherein the primer comprises a forward primer and a backward primer; and the kit is used for the quantitative detection of streptococcus pneumonia nucleic acid and comprises the primer and the fluorescence probe, and PCR reaction liquid, a DNA extraction solution, a negative quality control material, a positive quality control material, a critical positive quality control material and a working standard. The method for the quantitative detection of streptococcus pneumonia nucleic acid through using the primer, the fluorescence probe and the kid comprises the following steps: step 1, sample collection; step 2, sample processing; step 3, sample application; step 4, PCR amplification; and step 5, analysis and judgment. According to the real-time TaqMan fluorescence quantitative PCR provided by the embodiment of the invention, the primer and the fluorescence probe have high specificity and high sensitivity, the kit has precise quantification, and the detection method can rapidly detect the streptococcus pneumonia.

Description

technical field [0001] The invention relates to the technical field of biological detection, in particular to a primer for quantitative detection of Streptococcus pneumoniae nucleic acid, a fluorescent probe, a kit and a detection method thereof. Background technique [0002] Streptococcus pneumoniae (SP) belongs to Streptococcus family Streptococcus bacteria, Gram stain positive. It does not produce endotoxins and exotoxins, and its pathogenicity is mainly due to the invasion effect of the capsule: the non-capsulated variant strain is non-virulent, and the capsulated pneumococcus can resist the phagocytosis of phagocytes, which is conducive to the colonization of bacteria in the host and reproduce. Streptococcus pneumoniae can be divided into more than 90 serotypes according to the polysaccharide antigenicity of the bacterial capsule, and different serotypes have different pathogenicity. [0003] 75% of adult Streptococcus pneumoniae pneumonia and more than 50% of severe ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/11C12R1/46
Inventor 唐景峰罗虹王业富
Owner WUHAN BIOTECH GENE ENG
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products