Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Plants expressing cell wall degrading enzymes and expression vectors

A carrier and plant technology, applied in the direction of hydrolytic enzymes, plant cells, plant products, etc., can solve problems such as adverse phenotypic effects

Active Publication Date: 2012-10-03
AGRIVIDA
View PDF7 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Hydrolases have important industrial and agricultural applications, but their host-dependent expression and production can have unwanted phenotypic effects

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Plants expressing cell wall degrading enzymes and expression vectors
  • Plants expressing cell wall degrading enzymes and expression vectors
  • Plants expressing cell wall degrading enzymes and expression vectors

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1-p

[0104] Example 1 - pSB11

[0105] see figure 1 , the vector in one embodiment of the present invention can be based on the pSB11 intermediate plasmid (a derivative of pBR322). pSB11 was obtained from Japan Tobacco. The pSB11 plasmid is suitable for cloning and is easily maintained in E. coli. The two vectors are coupled and maintained in LB4404 Agrobacterium by homologous recombination using cos and ori sites present in both pSB11 and pSB1 "super binary" acceptor vectors (non-oncogenic Ti plasmids) within the strain. The integrated product represents a hybrid vector that can be used for subsequent plant transformation. pSB1 includes virulence genes such as virB, virC and virG that are essential for T-DNA processing and delivery to plant cells. pSB11 has multiple cloning sites including unique restriction enzyme recognition sites for cloning expression cassettes with gene sequences of interest.

Embodiment 2

[0106] Example 2 - pAG1000

[0107] see Figure 2A , pAG1000 was formed by modifying pSB11 to accept several gene expression cassettes. First, the original expression cassette including the positive selectable marker gene manA encoded by Ye Phosphomannose Isomerase (PMI) Driven by C.

Embodiment 3

[0108] Example 3 - pAG1001, pAG1002 and pAG1003

[0109] pAG1000 was further modified by removing the EcoRI site (nucleotide position #7) to form pAG1001 ( Figure 2B ), and then remove the KpnI site (nucleotide position #1) to form pAG1002 ( Figure 2C ). These modifications made the EcoRI and KpnI sites available for subsequent cloning of the expression cassette with the gene of interest (GOI). see Figure 3A , the following new multiple cloning site (MCS) sequence, including PacI, XhoI, SnaBI, NcoI, KpnI, XmaI, AvrII, EcoRI sites, was synthesized into a 249bp PmeI-HindIII fragment by PCR, and was cloned into pAG1002 In the PmeI-HindIII site, thus providing the pAG1003 vector.

[0110] >MCS

[0111] GTTTAAACTGAAGGCGGGAAACGACAACCTGATCATGAGCGGAGAATTAAGGGAGTCACG

[0112] TTATGACCCCCCGCCGATGACGCGGGACAAGCCGTTTTACGTTTTGGAACTGACAGAACCGC

[0113] AACGTTGAAGGAGCCACTCAGCTTAATTAAGTCTAACTCGAGTTACTGGTACGTACCAAAT

[0114] CCATGGAATCAAGGTACCATCAATCCCGGGTATTCATCCTAGGTATCCAAGAATTCATA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
conversion efficiencyaaaaaaaaaa
Login to View More

Abstract

Vectors for expression of proteins in plants are described. The proteins may be enzymes and the enzymes can be but are not limited to cell wall degrading enzymes. A number of plants designed to express specific cell wall degrading enzymes are provided. The plants may have industrial and / or agricultural applications. Methods and materials for making the expression vectors and for making the plants are provided. Processes for which the plants could be used in industrial and agricultural applications are also provided.

Description

[0001] This application claims U.S. Provisional Application No. 61 / 280,635 filed on November 6, 2009 and U.S. Provisional Application No. 61 / 398,589 filed on June 28, 2010 as the basis of priority, the entire contents of these two provisional applications Incorporated herein by reference. This application is also a continuation-in-part of US Application No. 12 / 590,444, filed November 6, 2009, which is hereby incorporated by reference in its entirety. [0002] The sequence listing of this application is filed electronically with this application, entitled "Sequence Listing", created on November 5, 2010, and its size is 2,215,456 bytes. The entire content of the sequence listing is incorporated herein by reference. technical field [0003] The present disclosure relates to plants expressing cell wall degrading enzymes, vectors, nucleic acids, proteins, related methods and uses thereof. Background technique [0004] Hydrolases have important industrial and agricultural applica...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A01H5/00C12N5/04
CPCC12N15/8242A23K10/30C12N15/8205C12N9/2437C12N9/248C12N15/8216C12N15/8245C12N15/8246C12N15/8257C12N15/8261C12N15/8287C12P19/02C12P19/14C12Y302/01C12Y302/01004C12Y302/01008
Inventor R·M·莱布O·布格瑞V·萨莫伊洛夫N·埃克堡
Owner AGRIVIDA
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com