Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for improving moisture resistance of cabbage type rape

A Brassica napus, moisture tolerance technology is applied in the fields of rapeseed quality breeding and rapeseed transgenic breeding, and achieves the effects of time-consuming, cost reduction, manpower and economic cost.

Active Publication Date: 2012-09-19
INST OF OIL CROPS RES CHINESE ACAD OF AGRI SCI
View PDF1 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there is no report on the transformation of vgb into Brassica napus at home and abroad

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for improving moisture resistance of cabbage type rape
  • Method for improving moisture resistance of cabbage type rape
  • Method for improving moisture resistance of cabbage type rape

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0039] according to figure 1 It can be known that the present invention will be described in further detail.

[0040] A method for improving the moisture resistance of Brassica napus, the specific steps are:

[0041] A. Construction of expression vectors containing NPTII (kanamycin resistance gene) expression elements, Bar (glufosinate resistance gene) expression elements and target gene vgb (gene encoding Vitiligo hyaline hemoglobin)

[0042] 1. Use the vgb sequence published on the NCBI website (Genebank number: GBEU363512.1) as a template to design primers (forward primer: 5'GACGAGCTCATGTTAGACCAGCAAACCAT3'; reverse primer:

[0043] 5'GACATCTAGATTATTCAACCGCTTGAGCGT3'), PCR amplification was performed using plasmid DNA (pPZV, see Genetic Resources Table) as substrate.

[0044] PCR reaction system: the total volume is 50 μL, which contains 5 μL substrate DNA (50ng / μL), 5 μL 10×Taq Buffer (containing Mg2+), 1 μL dNTPs (10 mmol / L), 1U EX-Taq DNA polymerase (TaKaRa), 100ng eac...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for improving the moisture resistance of cabbage type rape. The method comprises the following steps of: (A), constructing a glufosinate-ammonium resistant expression vector containing vitreoscilla hemoglobin (vgb), namely, (1) obtaining a target fragment, (2) recovering a polymerase chain reaction (PCR) product, transforming and sequencing, (3) preparing transferred-deoxyribonucleic acid (T-DNA), (4) preparing Vector, (5) preparing the expression vector, and (6) preparing bacterial liquid of agrobacterium tumefaciens; (B), breeding a recovery line of the moisture-resistant cabbage type rape, namely transforming the vgb into R2 by an agrobacterium tumefaciens mediated method to obtain a T0 recovery line, and performing continuous selfing to obtain a T2 recovery line; (C), breeding a maintainer line of the moisture-resistant cabbage type rape, namely (a) transforming the vgb into 6098B by the agrobacterium mediated method to obtain a T0 maintainer line, and performing continuous selfing to obtain a T2 maintainer line, and (b) hybridizing a T1 recovery line single plant serving as a male parent with the 6098B, performing continuous backcrossing by taking the 6098B as a recurrent parent to obtain BC3, and performing selfing to obtain the T2 maintainer line; and (D), obtaining a sterile line of the moisture-resistant cabbage type rape. The method is easy and convenient to operate and obvious in effect, the cost can be reduced, and the breeding progress can be shortened.

Description

technical field [0001] The invention belongs to the field of rapeseed quality breeding and rapeseed transgenic breeding, and more specifically relates to a method for improving the moisture resistance of Brassica napus, which is applicable to the moisture resistance breeding of Brassica napus. Background technique [0002] Soil moisture in a saturated state for a long time will greatly affect crop growth. The Yangtze River Basin is the main rapeseed production area in China, accounting for about 3 / 4 of the national rapeseed output. However, the rainfall in this area is relatively high, which often exceeds the normal water demand of rapeseed. In addition, the rapeseed production in this area mainly adopts paddy and dry rotation, especially no-tillage with rice stubble. Planting mode, heavy soil, poor air permeability, difficult drainage, high groundwater level, so it is very easy to produce wet (stained) damage, affecting the normal growth of rapeseed, resulting in a decline ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/82C12N15/31A01H5/00A01H1/02
Inventor 陈玉峰胡琼李云昌梅德圣刘佳付丽李英德徐育松李晓琴
Owner INST OF OIL CROPS RES CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com