Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Genetically modified rice BT63 and LAMP (loop mediated isothermal amplification) detection primer group, detection kit and detection method of derived variety thereof

A technology of transgenic rice and detection kit, applied in the field of molecular biology, to achieve high sensitivity, easy identification, and strong strain-specific effects

Active Publication Date: 2012-08-15
广州迪澳生物科技有限公司 +1
View PDF1 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0010] Loop-Mediated Isothermal Amplification (Loop-Mediated Isothermal Amplification, hereinafter referred to as LAMP method) is a gene developed by Eiken Chemical Co., Ltd. in Japan around 2000 Amplification technology, which has the advantages of fast, simple, accurate operation, easy popularization, safety and reliability. At present, there is no kit that applies the LAMP method to the rapid detection of transgenic rice BT63 and its derivatives.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Genetically modified rice BT63 and LAMP (loop mediated isothermal amplification) detection primer group, detection kit and detection method of derived variety thereof
  • Genetically modified rice BT63 and LAMP (loop mediated isothermal amplification) detection primer group, detection kit and detection method of derived variety thereof
  • Genetically modified rice BT63 and LAMP (loop mediated isothermal amplification) detection primer group, detection kit and detection method of derived variety thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0056] Example 1 Kit containing chromogen and detection method thereof:

[0057] LAMP detection kit for transgenic rice BT63 and its derivatives, including primer solution, reaction solution, DNA polymerase, control and color reagent:

[0058] (1) Primer solution: Contains 5 μM outer primer 1, 5 μM outer primer 2, 40 μM inner primer 1, 40 μM inner primer 2, the four primers are:

[0059] Outer primer 1: TCTTGCCCGGCGTCAAT (SEQ ID No: 1)

[0060] Outer primer 2: TTCGTAGCCCCACCACTAC (SEQ ID No: 2)

[0061] Inner primer 1: TTGACTGGAGCGAGGCGATGGGATAATACCGCGCCACAT (SEQ ID No: 3)

[0062] Inner primer 2: GACCGCTGTTATGCGGCCATTCCTCTAGAGTCGACCTGC (SEQ ID No: 4)

[0063] (2) Reaction solution: Contains 10mM dNTP, 10×ThermoPol reaction buffer, 150mM MgSO4 aqueous solution, the volume ratio of the three is 8:5:2;

[0064] (3) DNA polymerase: Bst DNA polymerase, the concentration is 8U / μl;

[0065] (4) Control: the positive control is the DNA of transgenic rice BT63 at a concentratio...

Embodiment 2

[0073] Embodiment 2 The kit and detection method thereof without chromogenic agent:

[0074] The kit is the same as that in Example 1 except that it lacks the chromogen in Example 1.

[0075] Use the above kit to detect the rice variety to be tested in the following way:

[0076] (1) DNA extraction of the sample to be tested: the DNA of the sample to be tested is extracted and purified by the CTAB method;

[0077] (2) Constant temperature gene amplification reaction: prepare reaction system in 200ul PCR tube: primer solution 1μl, reaction solution 12.5μl, DNA polymerase 1μl, DNA to be tested 2μl, make up to 25μl with sterilized deionized water; set positive control During the reaction, the DNA to be tested was replaced with the DNA of transgenic rice BT63 at a concentration of 5% or the Escherichia coli plasmid DNA containing the target gene. When setting a negative control reaction, the DNA to be tested was replaced with a reaction mixture without the target gene; The goo...

Embodiment 3

[0081] Embodiment 3 PCR reaction and the comparison of detection method sensitivity of the present invention:

[0082] Prepare the LAMP detection kit for transgenic rice BT63 and its derivatives according to the following formula:

[0083] (1) Primer solution: Contains 5 μM outer primer 1, 5 μM outer primer 2, 40 μM inner primer 1, 40 μM inner primer 2, the four primers are:

[0084] Outer primer 1: TCTTGCCCGGCGTCAAT (SEQ ID No.1)

[0085] Outer primer 2: TTCGTAGCCCCACCACTAC (SEQ ID No.2)

[0086] Internal primer 1: TTGACTGGAGCGAGGCGATGGGATAATACCGCGCCACAT (SEQ ID No. 3)

[0087] Internal primer 2: GACCGCTGTTATGCGGCCATTCCTCTAGAGTCGACCTGC (SEQ ID No. 4)

[0088] (2) Reaction solution: Contains 10mM dNTP, 10×ThermoPol reaction buffer, 150mM MgSO4 aqueous solution, the volume ratio of the three is 8:5:2;

[0089] (3) DNA polymerase: Bst DNA polymerase, the concentration is 8U / μl;

[0090] (4) Control: the positive control is the DNA of transgenic rice BT63 at a concentratio...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses genetically modified rice BT63, an LAMP (loop mediated isothermal amplification) detection primer group, a detection kit and a detection method, a detection kit and a detection method of the genetically modified rice BT63. The detection primer group comprises four specific primers; the detection kit comprises primer liquid, reaction liquid, DNA (deoxyribonucleic acid) polymerase, a reference and also a color reagent. The detection method comprises the steps that a DNA template of a sample is amplified at 63-65 DEG C by extracting DNA of rice variety of rice to be detected and adopting four specific primers and one DNA polymerase with strand displacement activity, wherein the amplification efficiency can achieve 109-1010 copies in a short time, and the identification is as follows: SYBRGreen I is added to observe the color change or a turbidity meter is utilized for observing the turbidity change of sediments in a reaction tube so as to judge whether amplification is conducted or not, so that whether the rice variety to be detected contains genetically modified rice BT63 and the derived variety thereof or is genetically modified rice BT63 and the derived variety thereof is ensured. The detection method provided by the invention has the advantages of rapidness, high efficiency, easiness and convenience in operation, high specificity, high flexibility, easiness and convenience in identification, and suitability of on-site detection, and is suitable for promotion and application.

Description

technical field [0001] The invention belongs to the technical field of molecular biology, and relates to a detection method of a transgenic plant variety, in particular to a LAMP detection primer set, a detection kit and a detection method of the transgenic rice BT63 and its derivative varieties. Background technique [0002] According to the report "2010 Global Biotech / GM Crops Commercialization Development Status" recently published by the International Agricultural Biotechnology Application Service, about 100 million farmers have made planting decisions in the past 15 years due to the huge benefits brought by genetically modified crops . In the 15 years since GM crops were commercially planted, the cumulative area of ​​GM crops in the world has exceeded 1 billion hectares. In 2010, 15.4 million farmers in 29 countries around the world planted a total of 148 million hectares of biotech crops. From 1996 to 2010, the global hectarage of biotech crops increased 87-fold. Fo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11
Inventor 叶宇鑫刘津高东微吴少云肖艳文石磊
Owner 广州迪澳生物科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com