Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Anti-soybean mosaic virus (SMV) protein in soybean and coding gene Rsv3C and application thereof

A protein and soybean technology, applied in the application, genetic engineering, plant genetic improvement and other directions, can solve the problems of affecting the appearance quality of soybeans, reducing soybean yield, threatening agricultural safety, etc., to enhance market competitiveness and meet the requirements of variety resistance , the effect of controlling the harm of SMV

Inactive Publication Date: 2013-10-02
NANJING UNIV
View PDF3 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

SMV not only reduces the yield of soybeans, but also causes mottled grains, affects the appearance and quality of soybeans, and directly threatens the increase of soybean farmers' income and the agricultural security of the country
Whether at home or abroad, the prevention and treatment of soybean mosaic disease has always been a priority research topic to ensure the sustainable production of soybeans, but there is currently no effective agent for the prevention and control of SMV

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Anti-soybean mosaic virus (SMV) protein in soybean and coding gene Rsv3C and application thereof
  • Anti-soybean mosaic virus (SMV) protein in soybean and coding gene Rsv3C and application thereof
  • Anti-soybean mosaic virus (SMV) protein in soybean and coding gene Rsv3C and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] (2) Through the software Oligo6, design specific primers for Rsv3C ( figure 2 ), the primer sequence is:

[0024] Upstream CGGAATTCCGAGCGACAAGTCATGGTAT;

[0025] Downstream TCCCCGCGGGGATATGAGGGGTGTTAGTGTCTGA;

[0026] (3) Precocious 18 soybeans were planted, about 5 grams of leaves were collected two weeks later, the genomic DNA was extracted by the improved CTAB method, and the concentration and purity of the obtained DNA were detected by 0.8% agarose gel electrophoresis and ultraviolet spectrophotometer. Using genomic DNA as a template (concentration controlled at 20ng / μL), use the specific primers designed in step (2), use TAKARA's LA-Taq enzyme and supporting reagents, and use the Long-PCR method to amplify the NBS-LRR type Candidate gene Rsv3C. The PCR program used was: pre-denaturation at 94°C for 5 minutes, denaturation at 94°C for 30 seconds, renaturation at 56°C for 45 seconds, extension at 68°C for 7 minutes, a total of 30 cycles, renaturation at 68°C for ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an anti-soybean mosaic virus (SMV) protein in soybean and a coding gene Rsv3C and application thereof. The amino acid sequence of the protein is shown as SEQ ID NO. 1. The nucleotide sequence of the gene is shown as SEQ ID NO. 2. The cloned Rsv3C functional anti-SMV gene can be used as a target gene and introduced into high-yield soybean varieties; and the R protein coded by the gene can identify effect factors released by corresponding SMV pathogens and excite resistance response, so that the disease resistance of plants is improved and the aim of improving plant varieties is fulfilled.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to soybean anti-SMV protein and its coding gene Rsv3C and their application in cultivating SMV-resistant soybeans. Background technique [0002] Soybean is an important source of plant protein and edible oil, but soybean mosaic disease caused by soybean mosaic virus (SMV) is one of the most serious soybean diseases worldwide. In various soybean producing areas in my country, SMV causes a considerable degree of damage every year, and with the evolution of virus toxicity, the yield loss tends to increase year by year. For example, the vegetable soybean variety "Taiwan 75" introduced from Taiwan's "Yashu" was almost extinct in many areas of Jiangsu and Zhejiang provinces due to severe infection with soybean mosaic virus. SMV not only reduces soybean yield, but also causes mottled grains, affects the appearance and quality of soybeans, and directly threatens the increase of soy...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/415C12N15/29C12N15/63C12N1/21C12N5/10C12N15/82C12N15/84A01H5/00
Inventor 王斌陈建群程浩喻德跃冯雪影
Owner NANJING UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products