Insecticidal Bt (Bacillus thuringiensis) protein Cry8Qa1, coding gene thereof and application thereof
A technology that encodes genes and bt proteins, applied in applications, insecticides, genetic engineering, etc., to achieve the effects of improving insect resistance, reducing costs, and good insecticidal activity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0031] Example 1 Cloning of cry8Qa1 gene
[0032] The new bacterial strain ST8 of Bacillus thuringiensis isolated from the soil in the plain area of Chengdu, Sichuan Province in the present invention has been obtained in the General Microorganism Center of China Microbiological Culture Collection Management Committee (Address: West Beichen, Chaoyang District, Beijing) on June 12, 2010. Road No. 1 Yard No. 3, Institute of Microbiology, Chinese Academy of Sciences, Zip Code 100101) preserved, classified as Bacillus thuringiensis (Bacillus thuringiensis), and the preservation number is CGMCCNo.3923.
[0033] The total DNA of strain ST8 was extracted using a genomic DNA purification kit (purchased from Saibaisheng Company). And design the primer sequence as follows:
[0034] P1: 5'ATGAGTCCAAATAATCAAAAT 3'
[0035] P2: 5'TTACTCTACGTCAACAATTAA 3'
[0036] 25μl PCR reaction system:
[0037]
[0038]
[0039] Thermal cycle reaction: pre-denaturation at 94°C for 5 minutes...
Embodiment 2
[0040] Example 2 Obtaining of Cry8Qa1 protein
[0041] According to the sequence at both ends of the open reading frame of the cry8Qa1 gene, a pair of specific primers were designed and synthesized: cry8R: 5′-CG GAGCTC ATGAGTCCAAATAATCAAAAT-3′; cry8F: 5′-ATTTG CGGCCGC TTACTCTACGTCAACAATTAA-3',
[0042] The bases underlined at the 5' end primers are Sac I and Not I restriction sites, respectively. Amplify using ST8DNA as a template, and the amplified product is double digested with Sac I and Not I, and the digested product is connected with the vector pET-32a(+) after the same double digestion, and transformed into E.coliDH5α competent cells , and the recombinant plasmid was named pET-8Q. After the enzyme digestion electrophoresis of the recombinant plasmid verified that the size of the inserted fragment conformed to the target fragment ( figure 2 ), and then transformed into the recipient strain E.coli.BL21(DE3), and the recombinant containing the recombinant plasmid wa...
Embodiment 3
[0043] Example 3 Determination of the anti-insect effect of Cry8Qa1 protein
[0044] The insecticidal activity of cry8Qa1 gene expression product was tested against cotton bollworm, black beetle and North China black beetle respectively.
[0045] For Lepidoptera pests: the Cry8Qa1 protein obtained in Example 2 was formulated into 6 different concentrations from 1 μg / ml to 100ng / ml, and the old and tender cabbage leaves were selected to be washed and dried; irradiated under ultraviolet light for 15 minutes, cut into 2×2cm 2 Divide into different concentrations of Cry8Qa1 protein solution, soak for 5 minutes; take out and drain the excess liquid, put it in a sterilized petri dish to dry, use the leaves soaked in LB liquid medium as a control, put 4 pieces in each petri dish Leaves; 30 healthy 2-3 instar cotton bollworms were placed in each petri dish; each treatment was repeated 3 times, placed indoors, and the death of larvae was observed after 3 days, and the LC was calculate...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com