Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Insecticidal Bt (Bacillus thuringiensis) protein Cry8Qa1, coding gene thereof and application thereof

A technology that encodes genes and bt proteins, applied in applications, insecticides, genetic engineering, etc., to achieve the effects of improving insect resistance, reducing costs, and good insecticidal activity

Active Publication Date: 2012-02-29
SICHUAN AGRI UNIV
View PDF8 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the inevitable result of frequently making a single Bt insecticidal protein is resistance to Cry-like proteins due to the adaptation of pests; at present, many insect populations have successively developed resistance to insecticidal crystal proteins to varying degrees

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Insecticidal Bt (Bacillus thuringiensis) protein Cry8Qa1, coding gene thereof and application thereof
  • Insecticidal Bt (Bacillus thuringiensis) protein Cry8Qa1, coding gene thereof and application thereof
  • Insecticidal Bt (Bacillus thuringiensis) protein Cry8Qa1, coding gene thereof and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Example 1 Cloning of cry8Qa1 gene

[0032] The new bacterial strain ST8 of Bacillus thuringiensis isolated from the soil in the plain area of ​​Chengdu, Sichuan Province in the present invention has been obtained in the General Microorganism Center of China Microbiological Culture Collection Management Committee (Address: West Beichen, Chaoyang District, Beijing) on ​​June 12, 2010. Road No. 1 Yard No. 3, Institute of Microbiology, Chinese Academy of Sciences, Zip Code 100101) preserved, classified as Bacillus thuringiensis (Bacillus thuringiensis), and the preservation number is CGMCCNo.3923.

[0033] The total DNA of strain ST8 was extracted using a genomic DNA purification kit (purchased from Saibaisheng Company). And design the primer sequence as follows:

[0034] P1: 5'ATGAGTCCAAATAATCAAAAT 3'

[0035] P2: 5'TTACTCTACGTCAACAATTAA 3'

[0036] 25μl PCR reaction system:

[0037]

[0038]

[0039] Thermal cycle reaction: pre-denaturation at 94°C for 5 minutes...

Embodiment 2

[0040] Example 2 Obtaining of Cry8Qa1 protein

[0041] According to the sequence at both ends of the open reading frame of the cry8Qa1 gene, a pair of specific primers were designed and synthesized: cry8R: 5′-CG GAGCTC ATGAGTCCAAATAATCAAAAT-3′; cry8F: 5′-ATTTG CGGCCGC TTACTCTACGTCAACAATTAA-3',

[0042] The bases underlined at the 5' end primers are Sac I and Not I restriction sites, respectively. Amplify using ST8DNA as a template, and the amplified product is double digested with Sac I and Not I, and the digested product is connected with the vector pET-32a(+) after the same double digestion, and transformed into E.coliDH5α competent cells , and the recombinant plasmid was named pET-8Q. After the enzyme digestion electrophoresis of the recombinant plasmid verified that the size of the inserted fragment conformed to the target fragment ( figure 2 ), and then transformed into the recipient strain E.coli.BL21(DE3), and the recombinant containing the recombinant plasmid wa...

Embodiment 3

[0043] Example 3 Determination of the anti-insect effect of Cry8Qa1 protein

[0044] The insecticidal activity of cry8Qa1 gene expression product was tested against cotton bollworm, black beetle and North China black beetle respectively.

[0045] For Lepidoptera pests: the Cry8Qa1 protein obtained in Example 2 was formulated into 6 different concentrations from 1 μg / ml to 100ng / ml, and the old and tender cabbage leaves were selected to be washed and dried; irradiated under ultraviolet light for 15 minutes, cut into 2×2cm 2 Divide into different concentrations of Cry8Qa1 protein solution, soak for 5 minutes; take out and drain the excess liquid, put it in a sterilized petri dish to dry, use the leaves soaked in LB liquid medium as a control, put 4 pieces in each petri dish Leaves; 30 healthy 2-3 instar cotton bollworms were placed in each petri dish; each treatment was repeated 3 times, placed indoors, and the death of larvae was observed after 3 days, and the LC was calculate...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an insecticidal Bt protein Cry8Qa1 and a coding gene thereof. The protein has an amino acid sequence represented by SEQ ID NO. 2, or an amino acid sequence which is obtained through substituting, deleting and / or adding one or more of amino acids to the amino acid sequence represented by the SEQ ID NO. 2 and has same activities with the amino acid sequence represented by theSEQ ID NO. 2. The Bt protein Cry8Qa1 provided by the invention can be used for preparing Bt insecticides, the gene coding the protein can transform economical crops of grains, cotton, oil plants, andvegetables, and various plants of flowers, lawns and the like to make them have corresponding insecticidal activities, so the insecticide dosage is reduced and the environmental pollution is reduced,thereby the insecticidal Bt protein Cry8Qa1 has important economic values and application prospects.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a new insecticidal Bt protein, its coding gene and application. Background technique [0002] In the process of human production, insect pests are an important factor that causes agricultural production losses and affects human health. According to FAO statistics, the annual economic losses caused by insect pests in agricultural production worldwide are as high as 14%, disease losses reach 12%, and weed damage losses reach 11%. %. The loss was as high as 126 billion US dollars, equivalent to half of China's total agricultural output value, and more than four times that of the United Kingdom. Agricultural pests are mainly concentrated in Lepidoptera and Homoptera. Some insects in the Coleoptera Scarabidae, such as grubs, are also important worldwide distribution of underground pests, harming dicotyledonous and monocotyledonous food crops and various vegetables Seeds and seedlings so...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/325C12N15/32C12N15/63C12N5/10A01N47/44A01P7/04C12N15/82A01H5/00C12R1/07
Inventor 郑爱萍李平唐裕杰朱军王世全邓其明李双成王玲霞刘怀年
Owner SICHUAN AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com