Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for deducting CYP3A4 gene expression quantity

A gene expression and expression technology, applied in biochemical equipment and methods, microbial measurement/inspection, etc., can solve problems such as differences in CYP3A4 expression, differences in metabolic capacity, and low CYP3A4, so as to avoid adverse reactions and reduce costs and risk, the effect of improving safety and efficacy

Inactive Publication Date: 2012-02-08
CHINESE NAT HUMAN GENOME CENT AT SHANGHAI
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The activity of CYP3A4 is related to its expression in the human liver, and its expression level can determine the efficacy and safety of the drug. However, due to the large individual differences in the expression of the CYP3A4 gene in the human body, the individual's metabolism of CYP3A4-related drugs There is considerable difference in ability, which brings difficulties to clinical safe and effective drug use
[0004] At present, the research on most of the genes related to drug metabolism is mainly carried out by detecting whether the polymorphism of the gene sequence is related to the expression level of genes related to drug metabolism or the change of the activity of the encoded protein, but most of the Gene polymorphisms are only meaningful in some studies or in certain populations, and the opposite results may be obtained in other studies
At the same time, due to the extremely low frequency of CYP3A4 in the population, it is currently impossible to use SNP (Single nucleotide polymorphism) detection to explain the considerable variation in the expression of CYP3A4 and its activity in the population. difference

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for deducting CYP3A4 gene expression quantity

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] The pathological biopsy samples of 73 cases of normal liver were collected, each case was about 50-200 mg. Immediately after the aforementioned samples were collected, they were immersed in 1mL RNALater and kept overnight at 4°C. After the samples were fully soaked by RNALater, they were transferred to -70°C for storage. After the samples were homogenized, DNA and RNA were extracted using Qiagen's AllPrep DNA / RNA Mini Kit.

[0026] Using PrimeScript TM 1st Strand cDNA synthesis kit, reverse transcription to produce cDNA.

[0027] Using human genomic DNA (Promega, Catalog No.G152A) as a standard and ACTB gene as a reference gene, the relative expression of CYP3A4 in each liver sample was detected by fluorescent real-time quantitative PCR on an ABI7900HT instrument. The primers for quantitative PCR are forward GCTCTTCAAGAAATCTGTGCCTG (SEQ ID NO: 4), reverse TCTACACAGACAATGAGAGAGCTCAA (SEQ ID NO: 5), the reaction system is 20 μl 1X QuantiTect SYBR Green PCR Master Mix, ...

Embodiment 2

[0031] The above-mentioned Example 1 verified that the methylation degree of the 159th base of the CYP3A4 gene sequence is related to the expression level of the CYP3A4 gene in the human body. The degree of kylation is used to infer the expression of CYP3A4 gene in the subject. The specific method is as follows:

[0032] Collect peripheral blood samples from subjects and extract DNA. After the DNA samples were treated with sodium bisulfite, they were amplified with specific BSP primers. The primers were forward GTAGTTTGATTTTAGATTGTTGTG (SEQ ID NO: 2); reverse TAACCCCTCCCTTACATTCTATT (SEQ ID NO: 3). After the amplified product was purified using Qiagen’s Qiaquick PCR Purification kit, it was ligated with the pMD18-T vector using T4 DNA ligase, transformed into DH5a competent bacteria, and no less than 20 positive clones were screened by blue and white. Then in situ colony PCR was carried out with vector universal primers T7 and SP6, and the products were sequenced directly. ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for deducting CYP3A4 gene expression quantity. The expression information of the CYP3A4 gene in human body can be deducted through detecting the methylation degree of a CpG site of the CYP3A4 gene in a human body blood DNA sample. The method is capable of deducting the activity of CYP3A4 enzyme in human body, explaining the individual difference of the drug effect and guiding the clinic and reasonable medication.

Description

technical field [0001] The invention relates to a method for estimating the expression level of CYP3A4 gene. Background technique [0002] Different people have great differences in the absorption, transportation and metabolism of the same drug, and the therapeutic effect and toxic side effects of the same prescribed dose of drug on different patients are very different. Therefore, for a long time, individual differences in drug effects have been It is an important factor affecting the efficacy of drugs in clinical treatment. One of the main reasons for individual differences in drug efficacy is the difference in drug metabolism. Drug metabolism is mainly performed by a series of drug-metabolizing enzymes. Therefore, the study of gene diversity of drug-metabolizing enzymes is the basis for understanding the reasons for individual differences in drug efficacy. . [0003] Cytochrome P4503A4 (Cytochrome P4503A4, abbreviated as CYP3A4) is the largest drug-metabolizing enzyme i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68
Inventor 黄薇施锦绣王大志寿维华
Owner CHINESE NAT HUMAN GENOME CENT AT SHANGHAI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com