Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for inducing plants to bloom early by populus tomentosa sepallata (PtSEP) gene of poplar

A gene and plant technology, applied in the field of plant early flowering induction, can solve the problems of long cycle, complicated breeding process, limited ability of flowering regulation method, etc., and achieve the effect of quick effect and short cycle

Inactive Publication Date: 2012-01-04
INST OF FORESTRY CHINESE ACAD OF FORESTRY
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The control ability of the flowering regulation method is limited, and the hybridization method needs corresponding parental materials, and the cycle is long and the breeding process is complicated

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

specific Embodiment approach

[0016] Poplar PtSEP gene of the present invention is used for the method for plant early flowering induction, and its preferred embodiment comprises:

[0017] Using the PtSEP gene of poplar as the target gene, cloning its full-length cDNA, constructing the overexpression vector of the PtSEP gene and transferring it into the plant, so as to advance the flowering time of the plant;

[0018] The PtSEP gene includes the following cDNA sequence or a DNA sequence with more than 90% homology and the same function as the following cDNA sequence:

[0019] ATGGGGAGAGGTAGGGTTGAGTTGAAGAGAATTGAGAACAAGATCAACAGGCAAGTAACATTTGCAAAGAGAAGGAATGGACTTTTGAAGAAAGCCTATGAGCTTTCCGTTCTTTGTGATGCAGAGATTGCTCTCATCATCTTCTCCAATAGAGGAAAGCTGTACGAGTTTTGCAGTAGTTCAAGCATGCTCAAAACTCTTGAGAGGTACCAGAAGTGCAACTATGGAGCACCAGAGCCAAATGTGTCAGCAAGGGAGGCCTTGGAACTGAGTAGCCAGCAGGAATATCTGAAGCTTAAAGCACGCTACGAAGCTCTGCAAAGAACCCAGAGGAATCTTTTGGGAGAAGACCTTGGCCCTCTGAGCAGCAAAGAGCTTGAATCACTTGAAAGACAGCTTGATATGTCACTGAAGCAGATCAGATCAACAAGGACCCAGT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for inducing plants to bloom early by a populus tomentosa sepallata (PtSEP) gene of poplar. In the method, the total length of complementary deoxyribonucleic acid (cDNA) of the PtSEP gene, which is the target gene, of the poplar to construct an ultra-expression vector of the PtSEP gene, and the ultra-expression vector is transferred into a plant to advance the blossom time of the plant such as tobacco and the like. The early flowering induction of the plants and particularly flowers is performed by utilizing the transgenic technology, the period is short and the effectiveness is quick.

Description

technical field [0001] The invention relates to a method for inducing early flowering of plants, in particular to a method for inducing early flowering of plants using poplar PtSEP gene. Background technique [0002] The flowering decision process is the first stage of plant reproductive growth initiation, which directly controls the early or late of plant growth period, so it is closely related to plant products. Can allow its early flowering for flower plant, to produce the product that people need. Early flowering of some plants is beneficial to the growth of fruit, changing the growth cycle and breeding cycle, and it is possible for farmers to grow one season in a year. Delaying flowering of crops such as vegetables is beneficial for them to produce more leaves, because flowering consumes excess nutrients and energy. [0003] In the prior art, the flowering period of plants is generally regulated by flowering period regulation (such as plant hormones) and greenhouse te...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/84A01H5/00
Inventor 卢孟柱唐雯戚晓利赵树堂王敏杰胡建军郭伟
Owner INST OF FORESTRY CHINESE ACAD OF FORESTRY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products