Method for inducing plants to bloom early by populus tomentosa sepallata (PtSEP) gene of poplar
A gene and plant technology, applied in the field of plant early flowering induction, can solve the problems of long cycle, complicated breeding process, limited ability of flowering regulation method, etc., and achieve the effect of quick effect and short cycle
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
specific Embodiment approach
[0016] Poplar PtSEP gene of the present invention is used for the method for plant early flowering induction, and its preferred embodiment comprises:
[0017] Using the PtSEP gene of poplar as the target gene, cloning its full-length cDNA, constructing the overexpression vector of the PtSEP gene and transferring it into the plant, so as to advance the flowering time of the plant;
[0018] The PtSEP gene includes the following cDNA sequence or a DNA sequence with more than 90% homology and the same function as the following cDNA sequence:
[0019] ATGGGGAGAGGTAGGGTTGAGTTGAAGAGAATTGAGAACAAGATCAACAGGCAAGTAACATTTGCAAAGAGAAGGAATGGACTTTTGAAGAAAGCCTATGAGCTTTCCGTTCTTTGTGATGCAGAGATTGCTCTCATCATCTTCTCCAATAGAGGAAAGCTGTACGAGTTTTGCAGTAGTTCAAGCATGCTCAAAACTCTTGAGAGGTACCAGAAGTGCAACTATGGAGCACCAGAGCCAAATGTGTCAGCAAGGGAGGCCTTGGAACTGAGTAGCCAGCAGGAATATCTGAAGCTTAAAGCACGCTACGAAGCTCTGCAAAGAACCCAGAGGAATCTTTTGGGAGAAGACCTTGGCCCTCTGAGCAGCAAAGAGCTTGAATCACTTGAAAGACAGCTTGATATGTCACTGAAGCAGATCAGATCAACAAGGACCCAGT...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com