Method for evaluating unintended effect of molecular level of transgenic plant
A technology of transgenic plants and unexpected effects, applied in the field of molecular biology, can solve problems such as conclusion uncertainty, and achieve the effect of mature technology, simple and easy operation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0027]An example of an unintended effect study on the molecular level of Bt transgenic rice.
[0028] 1. Cloning and identification of foreign protein Bt gene
[0029] Analyze the sequence of the target gene fragment and the multi-cloning site information of the ligated vector, and design the following primers:
[0030] 5' primer: CC CATATG ATGGATAACAATCCGAACATC, the underlined part is the introduced Nde I restriction site;
[0031] 3' primer: GC GTCGAC ATCATATTCTGCCTCAAAGG, the underlined part is the introduced SalI restriction site;
[0032] The Bt gene fragment was obtained by PCR of Bacillus thuringiensis HD-1 strain (purchased from the Culture Collection Center, Institute of Microbiology, Chinese Academy of Sciences). 50 μL PCR system: 1 μL of 5’ primer, 1 μL of 3’ primer, 5 μL of 10×KOD buffer, MgSO 4 buffer 2μL, dNTP 5μL, KOD plus enzyme 1μL, ddH 2 O 35μL; PCR conditions: 94°C for 5min, 94°C for 30sec, 58°C for 30sec, 72°C for 2min, 39 cycles, and 72°C for 10min...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com