Preparation method of human papilloma virus virions, exogenous protein expression cassette and expression system

A technology of exogenous proteins and expression cassettes, applied in biochemical equipment and methods, viruses/bacteriophages, and the use of vectors to introduce foreign genetic materials, etc., can solve problems such as the advent of vaccines, achieve increased purification efficiency and stability, and extensive immune effects , increase the effect of immune effect

Inactive Publication Date: 2011-11-09
BEIJING INST OF BIOLOGICAL PROD
View PDF2 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

HPV58 may be the same as HPV16 and HPV18, and it is also the main HPV type for the occurrence and dissemination of cervical cancer. Currently, there is no vaccine against HPV58

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method of human papilloma virus virions, exogenous protein expression cassette and expression system
  • Preparation method of human papilloma virus virions, exogenous protein expression cassette and expression system
  • Preparation method of human papilloma virus virions, exogenous protein expression cassette and expression system

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0068] Example 1: Preparation and application of virus-like particles composed of HPV 16L1 and HPV 58L2 proteins

[0069] 1. Construction of exogenous fragment expression cassette

[0070] 1. Amplification of promoters and terminators:

[0071] Using the Hansenula (ATCC 26012) genome as a template, use The promoter and terminator of methanol oxidase gene (MOX) and dihydroxyacetone synthase gene (DAS) were amplified by PCR with HSDNA polymerase (purchased from TakaRa, Code No. DR010S). Herein, Hansenula ATCC 26012 is only exemplary and does not mean that the present invention is limited thereto.

[0072] Primers were designed according to the GenBank MOX promoter and terminator nucleotide sequences:

[0073] MOX(P)-F: AATTGTTGCCGCATGCATCCTTGC

[0074] MOX(P)-B: TTTGTTTTTGTACTTTTAGATTGATGT

[0075] MOX(T)-F: GGAGACGTGGAAGGACATACCGC

[0076] MOX(T)-B: ACAAAAGCTGGAGCTCAATCTCCGG;

[0077] Primers were designed according to the GenBank DAS promoter and terminator nucleotide ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
Diameteraaaaaaaaaa
Login to view more

Abstract

The invention relates to a preparation method of human papilloma virus virions. According to the method, human papilloma virus structural protein L1 and L2 are co-expressed in a methanol yeast expression system having a same double defect. An exogenous protein expression cassette used in the expression system comprises the following elements that: a) a marker gene sequence; b) a promoter region from methanol yeast comprises a promoter sequence b1 and the optional promoter upstream sequence b2; c) an exogenous protein DNA sequence; and d) a terminator region from the methanol yeast comprises a terminator sequence d1 and the optional terminator downstream sequence d2; wherein, the b) is located in the upstream of the c), and the d) is located in the downstream of the c); the marker gene sequence is selected from the coded methanol yeast LEU, URA, LYS, HIS or a ADE DNA sequence, and is located between b1 and b2 or d1 and d2; and the exogenous protein is human papilloma virus structural protein L1 or L2.

Description

technical field [0001] The invention relates to the field of biology, and more specifically, the invention relates to a preparation method of human papillomavirus virus-like particles, a foreign protein expression cassette, and a double-deficient methanol yeast expression system. Background technique [0002] Cervical cancer is an important disease that threatens women's health around the world, and its incidence rate ranks second among female tumors. Worldwide, approximately 470,000 cervical cancer patients are diagnosed each year. According to the 2007 survey by the American Cancer Center, there were 555,100 new cases and 309,800 deaths worldwide. Reproductive tract HPV (Human Papillomavirus, human papillomavirus) infection is a common sexually transmitted disease. In the United States, about 20 million people are disturbed at any time and can be transmitted to others at any time. The government spends about 6 billion US dollars every year Carry out the diagnosis, screen...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/81C12N7/01
Inventor 李启明张靖陈实靳玉琴马智静梁宇张学峰于洁卫江波沈心亮
Owner BEIJING INST OF BIOLOGICAL PROD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products