Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Chrysanthemum anti-retroelement DgZFP1, plant expression vector thereof, construction method thereof and application thereof

An anti-retro transcription factor and plant expression vector technology, applied in the field of molecular biology, can solve problems such as low efficiency and huge water resource consumption, and achieve the effects of improving salt tolerance, improving plant salt tolerance, and improving plant varieties.

Inactive Publication Date: 2012-07-04
NANJING AGRICULTURAL UNIVERSITY
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, with the continuous increase of the protected cultivation area of ​​chrysanthemums, soil salinization has gradually become the main limiting factor for the annual supply of chrysanthemums.
There are many deficiencies in the current soil improvement measures. At the same time, the huge consumption of water resources has become the bottleneck of the current chrysanthemum industry development.
Breeding for stress resistance of chrysanthemums has always been one of the important topics for horticultural workers at home and abroad. Given that stress resistance is a quantitative trait controlled by multiple genes, conventional breeding methods such as cross breeding are inefficient.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Chrysanthemum anti-retroelement DgZFP1, plant expression vector thereof, construction method thereof and application thereof
  • Chrysanthemum anti-retroelement DgZFP1, plant expression vector thereof, construction method thereof and application thereof
  • Chrysanthemum anti-retroelement DgZFP1, plant expression vector thereof, construction method thereof and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0039] Plant expression vector pCAMBIA 1301- DgZFP1 build

[0040] 1. DgZFP1 A clone of:

[0041]Choose the chrysanthemum 'Zhongshan Zigui' as the material, choose healthy cuttings, cut the surviving seedlings (20 days) in 200mM NaCl continuous stress treatment for 7 days, take 0.05g young leaves, refer to Trizol RNA extraction kit (TaKaRa) According to the method described in the manual, total RNA was extracted from leaves, and 1 μg of total RNA was reverse-transcribed into cDNA according to the M-MLV Reverse Transcription Kit (TaKaRa), and the cDNA product was digested with RNase. Capsicum annuum The sequence information of cys2 / his2-type zinc finger transcription factor (NCBI accession number: AY196704), analyzed and designed primer amplification by Primer 5 software DgZFP1 ;

[0042] Upstream primer DgZFP1-F: 5′- ATGGCAGTTGAAGCTCTAAACTCAC -3′

[0043] Downstream primer DgZFP1-R: 5′- ATGTTGTGTCGGGATCTCGAGCTTT -3′

[0044] Using the extracted leaf cDNA as a template...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a chrysanthemum anti-retroelement DgZFP1, a plant expression vector thereof, a construction method thereof and application thereof, belonging to the field of molecular biology. The expression vector pCAMBIA1301-DgZFP1 constructed by the invention is a recombinant plasmid which is obtained by the means that a DgZFP1 gene is inserted into a cloning vector pMD19-T simple vector (Takara), is performed by means of double digestion through BamH1 (Takara) and KpnI (Takara), and is connected with the BamH1 site and the KpnI site of the vector pCAMBIA1301 (Invitrogen). The plant expression vector is used for the genetic transformation of the plant, and the DgZFP1 gene is excessively expressed under the promotion of a CaMV35S promoter, so that a large number of the DgZFP1 protein is synthesized, the expression of the downstream gene is regulated and controlled, and the plant salt tolerance of the plant is improved.

Description

technical field [0001] The invention belongs to the field of molecular biology and relates to chrysanthemum anti-reverse transcription factor DgZFP1 The plant expression vector and construction method and application thereof. Background technique [0002] Abiotic stresses such as high salinity, drought and low temperature have a great impact on the yield and growth of crops. Therefore, the research on plant stress resistance has always been one of the hotspots in the field of botany research. Chrysanthemum is native to my country and is one of the top ten traditional famous flowers in my country and one of the four major cut flowers in the world. It has high ornamental and economic value and occupies an important position in flower production. However, with the continuous increase of the protected cultivation area of ​​chrysanthemums, soil salinization has gradually become the main limiting factor for the annual supply of chrysanthemums. There are many deficiencies in the ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/29C12N15/82C12N15/66A01H5/00
Inventor 陈素梅高海顺陈发棣朱喜荣刘兆磊房伟民蒋甲福宋爱萍
Owner NANJING AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com