Clam ferroprotein gene as well as coding protein and application of in vitro recombinant expression product of same
A technology of ferritin gene and expression products, which is applied in application, genetic engineering, plant genetic improvement, etc., can solve the problems of resource destruction of high-intensity harvesting of natural seedlings, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0013] A cloned clam ferritin gene has the sequence shown in SEQ ID NO.1.
[0014] The cDNA sequence cloning of clam ferritin gene among the present invention comprises the following steps:
[0015] a) extraction of clam total RNA and purification of mRNA;
[0016] b) Clam cDNA library construction;
[0017] c) determination of the EST sequence of the clam cDNA library;
[0018] d) Homology analysis of clam EST sequences and screening of ferritin gene fragments;
[0019] e) The complete sequence of the ferritin gene was obtained by RACE technology.
[0020] The specific operation is as follows:
[0021] a) Extraction of total RNA from clams and purification of mRNA: total RNA was extracted from clam larvae using Trizol reagent from Invitrogen, and mRNA was purified using Oligotex mRNA purification kit from QIAGENE.
[0022] b) Clam cDNA library construction: using Stratagene company cDNA Synthesis Kit and The Synthesis Kit (Stratagene) was used to synthesize cDNA. The d...
Embodiment 2
[0035] According to the cDNA sequence of SEQ ID NO.1, specific primers were designed. Using primers F2: GCC GGATCCATGGCAGATTCAAGACC and R2: CGCGTCGAC TTAGGATTGCAGTTCTCTGTC, the gene fragment encoding ferritin mature peptide was amplified by PCR, and the reaction was carried out in MJ Research PTC-100. The following cycle: denaturation at 94°C for 45s, annealing at 50°C for 45s, extension at 72°C for 40s, a total of 30 cycles, and finally extension at 72°C for 5min. It was cloned into pGEX-4T-1 expression vector according to the method of "Molecular Cloning Third Edition", and transformed into Escherichia coli BL21(DE3), and the expression frame was confirmed to be consistent with the sequence of SEQ ID NO.1 by sequencing. Inoculate positive clones into LB. medium, shake culture at 37°C until OD 600 0.6-0.8, add 1mM IPTG to induce for 3h, and centrifuge to save the bacterial pellet. The bacterial cells were treated with 1mg / mL egg white lysozyme for 30 minutes and then ultras...
Embodiment 3
[0041] Recombinant ferritin can provide products and technologies for growth regulation and immune enhancement in clam seed production. During seedling production, mature clam broodstock were selected and placed in seawater at 28°C to induce discharge. After the sperm and eggs are naturally fertilized in water, they develop into D-type larvae in about 20 hours. The density of clam larvae is 5 / ml water body, the seawater temperature is 27°C, and the salinity is 25. During the cultivation period, 100% of the water is changed every day, and 20,000 to 50,000 cells / ml of golden algae are fed. After the clams were cultivated to the 4th day, the shell length was about 180 μm. At this time, adding ferritin, the recombinant expression product in Example 2, to the water body can effectively increase the growth rate and metamorphosis rate of clam larvae.
[0042] clam ferritin
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com