Application of let-7/miR-98 family in preparation of medicament for treating disease related to FAS (Fatty Acid Synthase) gene
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0037] Computer Predicted Target of Example 1 miR-98
[0038] Computer prediction analysis of the binding sites of miR-98 and miR-23:
[0039] miR-23 is a microRNA associated with neuronal growth. Bioinformatics TargetScan (http: / / www.targetscan.org) analysis shows that let-7 / miR-98 and miR-23a / b can regulate the expression of FAS gene, and their binding sites exist in the 3'UTR two of FAS gene respectively. Stem-loop junctions and stem parts of the secondary structure (see figure 1 ). figure 1 The binding sites between let-7 / miR-98 and miR-23 and the secondary structure of the 3'UTR of the FAS gene are shown. The binding site between let-7 / miR-98 and the secondary structure of the 3'UTR of the FAS gene exists in the stem-loop junction region of the secondary structure of the 3'UTR of the FAS gene, while the binding site between miR-23 and the secondary structure of the 3'UTR of the FAS gene The site exists in the stem region of the secondary structure of the 3'UTR of the ...
Embodiment 2
[0040] Example 2. Flow cytometric analysis of the impact of microRNA on the FAS protein
[0041] (1) Cell culture: Hela cells Hela cells were obtained from the American Culture Collection (ATCC) and purchased from the Institute of Cells, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences. Cultured with DMEM plus 10% fetal bovine serum and 100U / ml penicillin-streptomycin, 37°C, 5% CO 2 Incubate and change the medium once every 2-3 days.
[0042] (2) Cell transfection: the day before transfection, 2×10 5 The cells were evenly seeded in a 6-well cell culture plate. The coverage rate of the cells in each well should be 30-50% when transfected the next day; use Lipofectamine 2000 Reagent (Invitrogen Company) to transfect miR-98, miR-23a / b mock nucleic acid and inhibitory nucleic acid, and control. These nucleic acid sequences are as follows:
[0043] Hsa-miR-98 simulated nucleic acid (double strand): 5'UGAGGUAGUAAGUUGUAUUGUU3'
[0044] ...
Embodiment 3
[0062] Effect of embodiment 3miR-98 on FAS gene expression
[0063] As described in Example 2, miR-98 mimetic nucleic acid was transfected in Hela cells to increase the expression of miR-98, and miR-98 inhibitory nucleic acid was transfected to inhibit the function of miR-98. After 48 hours, polymerase chain reaction (RT-PCR) was used to study the effect of miR-98 on endogenous FAS mRNA.
[0064] (1) RT-PCR quantification of miR-98:
[0065]miR-98 reverse transcription primer and Real-time PCR reaction probe were directly purchased from ABI (Applied Biosystems). Target gene quantitative primers Ribosomal protein L13a (RPL13A) was used as an internal reference gene, and the primers for the amplification template were designed with Oligo 6.71 software as follows: FAS sense strand 5′accaaggttctcatgaatctcc3′, antisense strand 5′tgactccagcaatagtggtgata3′; synthesis. RPL13A primer sense strand 5'CCTGGAGGAGAAGAGGAAAGAGA3', antisense strand 5'TTGAGGACCCTCTGTGTATTTGTCAA 3' were also...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com