Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for gathering foreign DNA in transgenosis product

A transgenic and product technology, applied in the field of detecting whether a sample contains transgenic components, can solve the problems of low copy number of exogenous DNA and false negatives, and achieve the effects of avoiding false negative results, fast detection time and cheap price

Inactive Publication Date: 2013-07-03
PEKING UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This method has a detection limit problem, because the detection methods we use now, such as PCR amplification or real-time fluorescent quantitative PCR detection, the amount of DNA template used in each detection reaction is 25-500ng. When it is low, it will cause false negative results because the sample contains too few copies of exogenous DNA

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for gathering foreign DNA in transgenosis product
  • Method for gathering foreign DNA in transgenosis product
  • Method for gathering foreign DNA in transgenosis product

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0047] Taking the transgenic soybean (strain: ARG04) produced by Monsanto as the detection object, take the detection of the exogenous gene CaMV35S promoter in the transgenic soybean as an example:

[0048] Primers used in this example:

[0049] 35S-A (upstream primer): 5'-TGGAAAAGGAAGGTGGCT-3' (SEQ ID NO: 1)

[0050] 35S-B (downstream primer): 5'-CTTGCGAAGGATAGTGGG-3' (SEQ ID NO: 2)

[0051] In this embodiment, the biotin-labeled target gene probe detects between the upstream primer and the downstream primer, and its sequence is:

[0052] 5'-CCTACAAATGCCATCATTGCG-3' (SEQ ID NO: 3)

[0053] The exogenous target gene detected is the CaMV 35S promoter, and the promoter sequence is (SEQ ID NO: 4):

[0054] tggaaaagga aggtggctcc tacaaatgcc atcattgcga taaaggaaag gccatcgttgaagatgcctc tgccgacagt ggtcccaaag atggaccccc acccacgagg agcatcgtggaaaaagaaga cgttccaacc acgtcttcaa agcaagtgga ttgatgtgat atctccactgacgtaaggga tgacgcacaa tcccactatc cttcgcaaga cccttcctct atataaggaagttcatttca tttg...

experiment example

[0060] 1. PCR detection of DNA extraction solution:

[0061] Using the sterile aqueous solution of DNA obtained in Example 1 as a template, electrophoresis analysis was performed after PCR amplification. figure 2 To represent the electrophoresis analysis chart of DNA extraction solution PCR detection result:

[0062] from figure 2 As can be seen from the PCR detection results, there is no other amplified gene interference in the PCR reaction (4,5 negative control has no specific band), and the primers used are specific; the genes of non-transgenic soybeans will not be amplified (2,5) 3 has no specific band); the primers used can amplify the target fragment of transgenic soybean (1 has a specific band).

[0063] 2. Detection of the limit concentration (the concentration that the PCR reaction just cannot amplify):

[0064] After multiple dilutions of the sterile aqueous solution of DNA obtained in Example 1, electrophoresis analysis was performed after PCR amplification. ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for gathering foreign DNA in a transgenosis product, which comprises the following steps that: 1) extracting DNA of the transgenosis product; 2) adding buffer solution and nucleic acid probe marked with biotin in the DNA extract liquid obtained in the step 1), and degenerating, annealing and cooling the mixture to the room temperature after uniformly mixing the solution; 3) adding magnetic beads with the surface being marked with Streptavidin into the solution obtained in the step 2), adsorbing the magnetic beads in a magnetic field after uniformly mixing thesolution, and utilizing buffer solution to wash the magnetic beads; 4) arranging the magnetic beads obtained in the step 3) in the buffer solution, heating the buffer solution to more than 80 DEG C, maintaining the temperature for a period of a time, and taking the upper clean liquid to obtain the gather foreign DNA fragment. The method can effectively improve the abundance of the foreign DNA in the DNA solution to be detected, can more correctly detect and judge whether the crops or food contains the transgenosis composition of micro proportion, has rapid detection time, is free from requiring particular reagent material, and has low cost.

Description

technical field [0001] The present invention relates to a method for detecting whether a sample contains transgenic components, in particular to a method for enriching exogenous DNA in transgenic products based on the specificity of a magnetic bead-nucleic acid probe platform, which can increase the concentration of exogenous DNA in the DNA template finally used for detection reactions. Source DNA abundance. Background technique [0002] At present, in the laboratory to detect whether a sample contains genetically modified components, it is generally to analyze whether the DNA of the sample contains foreign DNA or to analyze whether the protein of the sample contains foreign protein components. When analyzing the DNA of the sample, it involves the extraction of the sample DNA, the amplification of the target fragment (PCR) and the detection of the amplification effect (real-time detection of fluorescent quantitative PCR, electrophoretic pattern analysis, dHPLC analysis, etc....

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68C12N15/10
Inventor 许崇任舒畅许昌王戎疆
Owner PEKING UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com