Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for detecting desoxyribonucleic acid anti-counterfeiting maker by utilizing loop-mediated isothermal amplification technology

A deoxyribonucleic acid, isothermal amplification technology, applied in the field of rapid identification, can solve the problems of aerogel contamination, false positives, and can only be sent back to professional laboratories for testing

Active Publication Date: 2013-10-02
孙星江
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

These instruments are very expensive and require trained professionals to operate, which makes the final judgment of the authenticity of a labeled substance still only sent back to a professional laboratory. In addition, the use of polymerase chain reaction for nucleic acid amplification It takes 2 to 3 hours to carry out agarose gel electrophoresis identification results, which not only requires operators to have skilled molecular biology techniques, but also requires operators to be in contact with carcinogen ethidium bromide and other toxic and harmful substances that have serious impact on health for a long time. Chemical material
At the same time, due to the inherent shortcomings of this technology, it is necessary to open the tube to take out the PCR products for electrophoresis to interpret the results, which cannot fundamentally avoid the common problem of airgel contamination of PCR products
As long as the operator is a little careless, false positive results may be caused by cross-contamination
The above shortcomings make the method of detecting nucleic acid markers by polymerase chain reaction severely limited in practical application.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for detecting desoxyribonucleic acid anti-counterfeiting maker by utilizing loop-mediated isothermal amplification technology
  • Method for detecting desoxyribonucleic acid anti-counterfeiting maker by utilizing loop-mediated isothermal amplification technology
  • Method for detecting desoxyribonucleic acid anti-counterfeiting maker by utilizing loop-mediated isothermal amplification technology

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021] Example 1 detects the deoxyribonucleic acid marker with polycarbonate as the medium and develops color with calcein.

[0022] First select the appropriate DNA marker sequence. In this experimental example, a 456bp fragment on the pGEM T easy plasmid (purchased from Promega Company) was used as the marker sequence. Its full sequence is as follows:

[0023] >F1

[0024] Aaattgtaagcgttaatattttgttaaaattcgcgttaaatttttgttaaatcagctcatttttta

[0025] accaataggccgaaatcggcaaaatcccttataaatcaaaagaatagaccgagatagggttgagtg

[0026] ttgttccagtttggaacaagagtccactattaaagaacgtggactccaacgtcaaagggcgaaaaa

[0027] ccgtctatcagggcgatggcccactacgtgaaccatcaccctaatcaagttttttggggtcgaggt

[0028] gccgtaaagcactaaatcggaaccctaaagggagcccccgatttagagcttgacggggaaagccgg

[0029]cgaacgtggcgagaaaggaagggaagaaagcgaaaggagcgggcgctagggcgctggcaagtgtag

[0030] cggtcacgctgcgcgtaaccaccacaccccgccgcgcttaatgcgccgctacagggcgcgt

[0031] SEQ ID NO: 1

[0032] Save the above sequence as a TXT text file named FI.txt ...

Embodiment 2

[0044] Embodiment 2 detects the deoxyribonucleic acid marker with polycarbonate as the medium and develops color with SYBR green

[0045] First select the appropriate DNA marker sequence. In this experimental example, a 456bp fragment on the pGEM T easy plasmid was used as the marker sequence. Its full sequence is as follows:

[0046] >F1

[0047] Aaattgtaagcgttaatattttgttaaaattcgcgttaaatttttgttaaatcagctcatttttta

[0048] accaataggccgaaatcggcaaaatcccttataaatcaaaagaatagaccgagatagggttgagtg

[0049] ttgttccagtttggaacaagagtccactattaaagaacgtggactccaacgtcaaagggcgaaaaa

[0050] ccgtctatcagggcgatggcccactacgtgaaccatcaccctaatcaagttttttggggtcgaggt

[0051] gccgtaaagcactaaatcggaaccctaaagggagcccccgatttagagcttgacggggaaagccgg

[0052] cgaacgtggcgagaaaggaagggaagaaagcgaaaggagcgggcgctagggcgctggcaagtgtag

[0053] cggtcacgctgcgcgtaaccaccacaccccgccgcgcttaatgcgccgctacagggcgcgt

[0054] SEQ ID NO: 1

[0055] Save the above sequence as a TXT text file named FI.txt

[0056] Upload the text f...

Embodiment 3

[0067] Example 3 Detects the deoxyribonucleic acid marker directly labeled without medium and develops color with calcein

[0068] First select the appropriate DNA marker sequence. In this experimental example, a 456bp fragment on the pGEM T easy plasmid (purchased from Promega Company) was used as the marker sequence. Its full sequence is as follows:

[0069] >F1

[0070] Aaattgtaagcgttaatattttgttaaaattcgcgttaaatttttgttaaatcagctcatttttta

[0071] accaataggccgaaatcggcaaaatcccttataaatcaaaagaatagaccgagatagggttgagtg

[0072] ttgttccagtttggaacaagagtccactattaaagaacgtggactccaacgtcaaagggcgaaaaa

[0073] ccgtctatcagggcgatggcccactacgtgaaccatcaccctaatcaagttttttggggtcgaggt

[0074] gccgtaaagcactaaatcggaaccctaaagggagcccccgatttagagcttgacggggaaagccgg

[0075] cgaacgtggcgagaaaggaagggaagaaagcgaaaggagcgggcgctagggcgctggcaagtgtag

[0076] cggtcacgctgcgcgtaaccaccacaccccgccgcgcttaatgcgccgctacagggcgcgt

[0077] SEQ ID NO: 1

[0078] Save the above sequence as a TXT text file named FI.txt. ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of anti-counterfeiting, and discloses a method for detecting authenticity of a marked object by amplifying signals of a desoxyribonucleic acid (DNA) anti-counterfeiting maker by utilizing a loop-mediated isothermal amplification technology. The method does not need professional molecular biology instruments, such as PCR amplifiers, gel imaging systems and the like, and a user can directly determine the authenticity detection result by unaided eyes. Due to high sensitivity and specificity of the loop-mediated isothermal amplification technology, the method enhances the response accuracy of the detection, reduces the amount of DNA required by marking an object, thereby enhancing the difficulty for counterfeiting and cracking; and enven realized that the object can even be directly marked by DNA without medium protection. Thus, the invention provides an improved quick and convenient method for detecting a DNA anti-counterfeiting maker as well as a method of making an object with DNA without medium protection.

Description

technical field [0001] The invention discloses a rapid identification technology of deoxyribonucleic acid (DNA) anti-counterfeiting markers. Disclosed is a method for performing signal amplification on a deoxyribonucleic acid (DNA) anti-counterfeit marker by using a loop-mediated isothermal amplification technology to detect and determine the authenticity of the marked object. The method can be applied to the rapid detection and identification of DNA anti-counterfeiting markers. Background technique [0002] When selling products, we often encounter the problem of imitation and counterfeiting. In addition, anti-counterfeiting technology and identification technology of anti-counterfeiting markers are required for authenticity identification such as famous paintings, antiques, certificates, and signatures. Most of the existing anti-counterfeiting technologies utilize technical barriers to prevent counterfeiters from counterfeiting. However, these barriers can be easily imi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68G01N21/64
Inventor 不公告发明人
Owner 孙星江
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products