Method for detecting desoxyribonucleic acid anti-counterfeiting maker by utilizing loop-mediated isothermal amplification technology
A deoxyribonucleic acid, isothermal amplification technology, applied in the field of rapid identification, can solve the problems of aerogel contamination, false positives, and can only be sent back to professional laboratories for testing
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0021] Example 1 detects the deoxyribonucleic acid marker with polycarbonate as the medium and develops color with calcein.
[0022] First select the appropriate DNA marker sequence. In this experimental example, a 456bp fragment on the pGEM T easy plasmid (purchased from Promega Company) was used as the marker sequence. Its full sequence is as follows:
[0023] >F1
[0024] Aaattgtaagcgttaatattttgttaaaattcgcgttaaatttttgttaaatcagctcatttttta
[0025] accaataggccgaaatcggcaaaatcccttataaatcaaaagaatagaccgagatagggttgagtg
[0026] ttgttccagtttggaacaagagtccactattaaagaacgtggactccaacgtcaaagggcgaaaaa
[0027] ccgtctatcagggcgatggcccactacgtgaaccatcaccctaatcaagttttttggggtcgaggt
[0028] gccgtaaagcactaaatcggaaccctaaagggagcccccgatttagagcttgacggggaaagccgg
[0029]cgaacgtggcgagaaaggaagggaagaaagcgaaaggagcgggcgctagggcgctggcaagtgtag
[0030] cggtcacgctgcgcgtaaccaccacaccccgccgcgcttaatgcgccgctacagggcgcgt
[0031] SEQ ID NO: 1
[0032] Save the above sequence as a TXT text file named FI.txt ...
Embodiment 2
[0044] Embodiment 2 detects the deoxyribonucleic acid marker with polycarbonate as the medium and develops color with SYBR green
[0045] First select the appropriate DNA marker sequence. In this experimental example, a 456bp fragment on the pGEM T easy plasmid was used as the marker sequence. Its full sequence is as follows:
[0046] >F1
[0047] Aaattgtaagcgttaatattttgttaaaattcgcgttaaatttttgttaaatcagctcatttttta
[0048] accaataggccgaaatcggcaaaatcccttataaatcaaaagaatagaccgagatagggttgagtg
[0049] ttgttccagtttggaacaagagtccactattaaagaacgtggactccaacgtcaaagggcgaaaaa
[0050] ccgtctatcagggcgatggcccactacgtgaaccatcaccctaatcaagttttttggggtcgaggt
[0051] gccgtaaagcactaaatcggaaccctaaagggagcccccgatttagagcttgacggggaaagccgg
[0052] cgaacgtggcgagaaaggaagggaagaaagcgaaaggagcgggcgctagggcgctggcaagtgtag
[0053] cggtcacgctgcgcgtaaccaccacaccccgccgcgcttaatgcgccgctacagggcgcgt
[0054] SEQ ID NO: 1
[0055] Save the above sequence as a TXT text file named FI.txt
[0056] Upload the text f...
Embodiment 3
[0067] Example 3 Detects the deoxyribonucleic acid marker directly labeled without medium and develops color with calcein
[0068] First select the appropriate DNA marker sequence. In this experimental example, a 456bp fragment on the pGEM T easy plasmid (purchased from Promega Company) was used as the marker sequence. Its full sequence is as follows:
[0069] >F1
[0070] Aaattgtaagcgttaatattttgttaaaattcgcgttaaatttttgttaaatcagctcatttttta
[0071] accaataggccgaaatcggcaaaatcccttataaatcaaaagaatagaccgagatagggttgagtg
[0072] ttgttccagtttggaacaagagtccactattaaagaacgtggactccaacgtcaaagggcgaaaaa
[0073] ccgtctatcagggcgatggcccactacgtgaaccatcaccctaatcaagttttttggggtcgaggt
[0074] gccgtaaagcactaaatcggaaccctaaagggagcccccgatttagagcttgacggggaaagccgg
[0075] cgaacgtggcgagaaaggaagggaagaaagcgaaaggagcgggcgctagggcgctggcaagtgtag
[0076] cggtcacgctgcgcgtaaccaccacaccccgccgcgcttaatgcgccgctacagggcgcgt
[0077] SEQ ID NO: 1
[0078] Save the above sequence as a TXT text file named FI.txt. ...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap