Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Firefly luciferase and preparation method thereof

A luciferase and firefly technology, which is applied in the field of firefly luciferase and preparation, can solve the problems of low stability of enzyme activity, cumbersome preparation method steps, time-consuming and the like, and achieves the improvement of enzyme activity stability and the rapid and efficient preparation method. Effect

Inactive Publication Date: 2010-01-27
SUZHOU R PROTAGEN
View PDF0 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

With the development of genetic engineering technology, various recombinant luciferase expression vectors and expression products have been used in various research fields, but according to existing reports, such recombinant luciferase will lose its activity rapidly when exposed to the outside world , the stability of the enzyme activity is low, and various chromatographic techniques are required for separation and purification, resulting in cumbersome steps, time-consuming and troublesome operations for the preparation of the existing firefly luciferase

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Firefly luciferase and preparation method thereof
  • Firefly luciferase and preparation method thereof
  • Firefly luciferase and preparation method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0017] The present invention will be further described below in conjunction with the accompanying drawings and the sequence listing.

[0018] 1. Preparation of DNA molecule encoding firefly luciferase

[0019] The synthesis of DNA molecules adopts a thermodynamically balanced inside-out (TBIO) PCR-based gene synthesis method (Thermodynamically balanced inside-out (TBIO) PCR-based gene synthesis), see Nucleic Acids Research, 2003, Vol.31, No. .22. The base sequence of the synthesized DNA molecule is shown as sequence 1 in the sequence listing.

[0020] 2. Construction of recombinant firefly luciferase expression vector pPLagg-1-Luc

[0021] According to the complete cDNA sequence of luciferase and the multiple cloning site sequence of the expression vector pPLagg, a pair of specific PCR primers were designed:

[0022] pPLagg-Luc-S: 5'GCGCGAATTCGCAGATAAGAATATTTTATATGGG 3'

[0023] pPLagg-Luc-AS: 5'AGTCAAGCTTCCCATTGGTGTGTTTTTCTAA 3'

[0024] Among them, pPLagg-Luc-S contains ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a novel firefly luciferase. The luciferase is obtained by adding an amino acid segment at the N terminal of a natural luciferase protein; thus, the luciferase has higher stability of the enzyme activity in comparison with naturally extracted luciferase or recombined natural luciferase. The invention further discloses a DNA molecule coding the firefly luciferase and a method for preparing the luciferase; the DNA molecule of the luciferase is used for constructing a recombinant expression vector; the expression vector is transfected into a host cell to form a transformant; the recombined firefly luciferase is obtained by inducing and expressing the expression vector in the transformant; and the recombined luciferase is separated and purified by high-salt deposition. After recombined luciferase is deposited under high salt condition, the luciferase is separated and purified by centrifuging, and the preparation method of the luciferase has simple operation and high efficiency, and saves time.

Description

technical field [0001] The present invention relates to a firefly luciferase and a preparation method thereof, in particular to an amino acid sequence of firefly luciferase and a base sequence of a DNA molecule encoding the luciferase, using a recombinant expression vector and a transformant containing the DNA molecule Method for preparing firefly luciferase. Background technique [0002] Firefly luciferase (firefly luciferase) belongs to the oxidoreductase class, is a kind of high-efficiency biocatalyst that can convert chemical energy into light energy, the firefly luciferase in ATP, Mg 2+ In the presence of oxygen, luciferin is used as a substrate to carry out an oxidation reaction and emit photons. ATP is an important energy chemical present in all living organisms. The ATP bioluminescent counting method utilizes the specific biochemical reaction between ATP and firefly luciferin-luciferase complex to determine the ATP content in the sample: when the luciferin substrat...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/02C12N15/53C12N15/63C12N1/21C12Q1/66G01N21/64C12R1/19
Inventor 吴一凡王滨
Owner SUZHOU R PROTAGEN
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com