Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Schistosoma japonicum microsatellite locus and application thereof

A technology of microsatellite loci and schistosomiasis, applied in the fields of biotechnology and genetics, can solve problems such as lack

Active Publication Date: 2009-10-28
STATION OF VIRUS PREVENTION & CONTROL CHINA DISEASES PREVENTION & CONTROL CENT +2
View PDF0 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the lack of a complete genome database of Schistosoma japonicum, the loci used in many studies are microsatellite loci of Schistosoma mansoni, which brings problems to research and application work

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Schistosoma japonicum microsatellite locus and application thereof
  • Schistosoma japonicum microsatellite locus and application thereof
  • Schistosoma japonicum microsatellite locus and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0072] Example 1 SSR acquisition and primer design

[0073] 1. DNA extraction of adult samples

[0074] Using DNA phenol extraction and ethanol precipitation method:

[0075] 1) Take a single insect and put it in 200μl extraction buffer to wash the insect body 3 times, and centrifuge at 2000g for 2min to separate the washing liquid;

[0076]2) Aspirate the washing solution, add 20μl extraction buffer, and use an RNAase-free sterile small grinding rod to grind the insect body to a homogenate;

[0077] 3) Add extraction buffer to a final volume of 50μl;

[0078] 4) Add 0.5μl RNAase (10ug / μl), 5μl SDS (10%), 0.5μl protein digestion enzyme, and mix with a gun repeatedly;

[0079] 5) Digestion in a compound water bath constant temperature oscillator at 110 rpm and 56°C for 1 hour;

[0080] 6) Add an equal volume of 50μl of a 25:24:1 mixture of phenol:chloroform:isopropanol, mix well, 10000g, and centrifuge for 5min;

[0081] 7) Take the supernatant, add 50μl chloroform: isopropanol 24:...

Embodiment 2

[0102] Example 2. Genetic analysis taking locus sjpn1 as an example

[0103] 1. Based on the Sjpn 1 sequence, design the corresponding primers as follows:

[0104] F: TGAGCACAACTGTATATCCCAAA

[0105] R: TGGGCAGACATACCAGGTTC

[0106] 2. PCR reaction, amplify the corresponding target fragment on the whole genomic DNA of the Schistosoma japonicum sample.

[0107] The PCR cycle conditions are: 95°C for 5 minutes; 94°C for 45s, 55°C for 45s, 72°C for 45s, 30 cycles; 72°C for 10 minutes. The PCR reaction system is: 25ng genomic DNA, 2 units of SBS Taq polymerase, two-way primers 10pm each, 1.25mM MgCl2, 1μl 10× reaction buffer, 0.5μl dNTPs (2.5mM, TaKaRa).

[0108] 3. The PCR products are purified by conventional methods.

[0109] 4. Analysis of genetic characteristics, such as analyzing multiple genetic characteristics (such as Tongling, Guichi, Duchang, Changde, Yueyang, Shashi, Xichang). The available genetic analysis methods are as follows:

[0110] (1). Electrophoresis identificati...

Embodiment 3

[0115] Example 3. Preliminary detection and gene scanning of PCR amplified products

[0116] 1. Preliminary detection of PCR amplification products

[0117] Before performing gene scanning (Genscan) on the PCR products, the amplified PCR products are detected to ensure the success of the gene scanning experiment. The amplified PCR product should have a positive target band, and the band type of the target band should be single without dragging. figure 1 The electropherograms of PCR amplification products at site sjpn8 of 96 individual samples in Wuhan epidemic area. A single band of interest appears in each lane, with a size of about 250 bp.

[0118] 2. Operation of GeneMapper 4.0

[0119] Set up different control panels (Panel) according to the size of PCR products amplified from different sites, and run GeneMapper 4.0, the operation can refer to the instruction manual.

[0120] 3. Genetypes

[0121] Since Schistosoma japonicum is a diploid organism, there are two genotypes in a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a microsatellite locus and an application thereof in schistosome biometrical genetics. The microsatellite locus is provided with a nucleotide sequence selected form SEQ ID NO: 1-17. The microsatellite locus provides a genetic mark which can effectively apply the schistosome biometrical genetics research. The invention also provides a primer of a microsatellite locus sequence by special augmentation. The primer has favorable augmentation effect and unique augmentation product.

Description

Technical field [0001] The present invention belongs to the field of biotechnology and genetics. More specifically, the present invention relates to a class of Schistosoma microsatellite DNA and its application in the genetics of Schistosoma japonicum population. Background technique [0002] SSR (Simple Sequence Repeat), also known as microsatellite DNA, is an emerging molecular marker. It is a tandem repeat sequence of dozens of nucleotides composed of 2-5 nucleotides as repeat units. Distributed in different loci throughout the eukaryotic genome. The number of repeats of the same locus repeat unit in different individuals may be different, thus forming polymorphism, that is, SSR molecular marker. Compared with other molecular markers such as RFLP and RAPD, SSR has the advantages of high polymorphism, simple analysis, easy to realize automatic high-throughput screening, and low cost. After knowing its sequence, only need to synthesize primers and do a PCR reaction. The result i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/31C12N15/11C12Q1/04C12Q1/68
Inventor 冯正胡薇王升跃殷明波莫筱瑾徐斌张祥林
Owner STATION OF VIRUS PREVENTION & CONTROL CHINA DISEASES PREVENTION & CONTROL CENT
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com