Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Specific inference hog cholera virus genome sequence and method for efficiently curing hog cholera virus infection

A technology of swine fever virus and genome, applied in the field of medicine for treating swine fever virus infection, to achieve obvious therapeutic effects, prevent infection, and prevent disease and death

Inactive Publication Date: 2009-04-15
MILITARY VETERINARY RES INST PLA MILITARY MEDICAL ACAD OF SCI
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There is no report on the application of RNA interference method to produce drugs for the treatment of classical swine fever virus infection

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Specific inference hog cholera virus genome sequence and method for efficiently curing hog cholera virus infection
  • Specific inference hog cholera virus genome sequence and method for efficiently curing hog cholera virus infection
  • Specific inference hog cholera virus genome sequence and method for efficiently curing hog cholera virus infection

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0104] Example 1 siRNA design

[0105] Analyze the genome sequences of classical swine fever virus published in GenBank, select the conserved regions in the genome, and search for AA-N genes according to the requirements of RNAi technology. 29 The characteristic 31nt sequence is analyzed by BlastN and secondary structure. According to the BlastN analysis results, use VNTI3.0 software to analyze their physical and chemical parameters such as (G+C)%, Tm value, internal hairpin ring structure, and select (G+C )% lower sequence, designed for classical swine fever virus N pro Two siRNA molecules interfere with the sequence of the gene.

[0106] The designed sequence and its position in the CSFV genome are shown in Table 10:

[0107] Table 10 siRNA molecular interference sequence and its position

[0108] targeting genes

[0109] * : Position relative to reference strain shimen, GenBank accession number: AF092448.

Embodiment 2

[0110] Example 2 In vitro synthesis of siRNA:

[0111] Press T7 RiboMAX TM Express RNAi System (Promega) instructions design and synthesize the DNA sequence and T7 RNA polymerase binding sequence of the siRNA molecules of the two fragments selected in Example 1, and determine that the control sequence is the reverse sequence of the N1 sequence, see the attached figure 1 ; respectively synthesize and transcribe the template DNA of the sense strand and the antisense strand of each siRNA molecule, the sequence is as follows:

[0112] T7 RNA polymerase binding sequence: GGATCCTAATACGACTCACTATA

[0113] N1 sense strand template sequence:

[0114] AATCCGTCACTACCTGTCACCCTACCTATCCTATAGTGAGTCGTATTAGGATCC

[0115] N1 antisense strand template sequence:

[0116] AAGGATAGGTAGGGTGACAGGTAGTGACGGATATAGTGAGTCGTATTAGGATCC

[0117] N2 sense strand template sequence:

[0118] AATTTCCCGTGGCTAATCCACTTCAGGGTTCTATAGTGAGTCGTATTAGGATCC

[0119] N2 antisense strand template sequence:

[0120]...

Embodiment 3

[0131] The design method of embodiment 3 plasmid expression shRNA molecules:

[0132] According to the design requirements of pSilencer3.1H1H1Hygro (Ambion) shRNA vector, design the DNA sequence for expressing shRNA. The design strategy is shown in Table 12. In order to improve the efficiency of correct annealing of sequences into double-stranded DNA molecules, a PCR strategy is designed to use DNA polymerase to synthesize, split the DNA sequence expressing the target shRNA sequence into two partially complementary sequences, and then use VNTI3.0 to assist analysis , so that the complementary paired bases between the two split sequences are 21-23bp, and the paired bases of each split sequence itself are less than 10bp, so as to improve the efficiency of PCR synthesis of double-stranded template DNA.

[0133] The DNA sequences of each shRNA template designed and synthesized are shown in Table 12:

[0134] Table 12 generates template DNA sequences of shRNA molecules

[0135] ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a special genome sequence for disturbing a hog cholera virus and simultaneously discloses a method for effectively curing the infection of the hog cholera virus. The invention relates to a medicament for curing the infection of the hog cholera virus; the effective and special interruption RNA molecules for restraining the hog cholera virus can be obtained through designing the DNA template sequence of the special interruption RNA molecules which aim at the different genes of the hog cholera virus and utilizing T7, T3 or SP6RNA polymerase in vitro transcription systems and an in vitro transcription plasmid expression system which comprises an H1 or U6 promoter. The invention is suitable for industrial production. The invention also provides a biological agent produced by utilizing the method; the inhibition efficiency of the biological agent to CSFV achieves as high as 95.1 to 99.0 percent; and the infection of CSFV can be remarkably stopped in the body of sensitive animals for preventing the animals from disease and death.

Description

technical field [0001] The invention provides a genome sequence that specifically interferes with CSFV, and also discloses a method for efficiently treating CSFV infection, relates to a drug for treating CSFV infection, and belongs to the technical field of biopharmaceuticals. Background technique [0002] The swine fever virus involved in the present invention is abbreviated CSFV below. [0003] At present, passive immunization (injection of hyperimmune serum) and active immunization methods are generally adopted in order to prevent classical swine fever virus infection, but still can not prevent and treat swine fever epidemic completely. [0004] RNA interference (RNA interference, RNAi) was first reported in 1998. It is a brand-new technology that has been gradually developed in the past two years. one of the most effective methods and is used in the field of virology research. The key to applying RNAi technology to inhibit virus proliferation is to obtain efficient and...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/11C12N15/63A61K48/00A61P31/14C12N15/113
Inventor 涂长春徐兴然史子学
Owner MILITARY VETERINARY RES INST PLA MILITARY MEDICAL ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com