Subtype H5 avian influenza virus detection kit and use thereof
An avian influenza virus and kit technology, which is applied in the field of H5 subtype avian influenza virus detection kits, can solve the problems of complicated process, time-consuming and only detection, and achieves the effects of high sensitivity, simple and convenient operation, and high specificity.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0057] Embodiment 1, the preparation of H5 subtype avian influenza virus detection kit
[0058] 1. Synthesis of primers
[0059] Artificially synthesize the following 3 pairs of primers:
[0060] F3: GTGAATTGGAATATGGTAACTGC;
[0061] B3: CCATTCCCTGCCATCCTC;
[0062] FIP: CGATGGTGAGAGGGTGTATGTTTTAAACTCCAATGGGGGCG;
[0063] BIP: CTTGCGACAGGGCTCAGAAATTTTCTGCTATAGCTCCAAATAGTCC;
[0064] LF: TGTGGAATGGCATACTAGAGTT;
[0065] LB: AGCCCTCAAGGAGAGAGA.
[0066] 2. Preparation of LAMP reaction solution
[0067] Each 23 μL LAMP reaction solution contains the following components: 0.5 μmol Tris-HCl, 0.25 μmol KCl, 0.25 μmol (NH 4 ) 2 SO 4 , Tween20 0.025 μL, 0.2 μmol MgSO 4 , 20 μmol betaine (Betaine), 0.035 μmol each of the four deoxynucleotides (dNTPs), 0.04 μmol upstream inner primer (FIP), 0.04 μmol downstream inner primer (BIP), 0.004 μmol upstream outer primer (F3), 0.004 μmol Downstream outer primer (B3), 0.02 μmol upstream circular primer (LF), 0.02 μmol downstream circu...
Embodiment 2
[0070] Embodiment 2, the preparation of H5N1 subtype avian influenza virus detection kit
[0071] 1. Synthesis of primers
[0072] Same as Step 1 of Example 1.
[0073] 2. Preparation of LAMP reaction solution
[0074] Each 23 μL LAMP reaction solution contains the following components: 0.5 μmol Tris-HCl, 0.25 μmol KCl, 0.25 μmol (NH 4 ) 2 SO 4 , Tween20 0.025 μL, 0.2 μmol MgSO 4 , 20 μmol betaine (Betaine), 0.035 μmol each of the four deoxynucleotides (dNTPs), 0.06 μmol upstream inner primer (FIP), 0.06 μmol downstream inner primer (BIP), 0.008 μmol upstream outer primer (F3), 0.008 μmol Downstream outer primer (B3), 0.04 μmol upstream circular primer (LF), 0.04 μmol downstream circular primer (LB), 16 U of Bst DNA polymerase, 0.2 U of AMV reverse transcriptase, sterile double distilled water.
[0075] 3. Assembly of kit
[0076] Same as Step 3 of Example 1.
Embodiment 3
[0077] Embodiment 3, the preparation of H5 subtype avian influenza virus detection kit
[0078] 1. Synthesis of primers
[0079] Same as Step 1 of Example 1.
[0080] 2. Preparation of LAMP reaction solution
[0081] Each 23 μL LAMP reaction solution contains the following components: 0.5 μmol Tris-HCl, 0.25 μmol KCl, 0.25 μmol (NH 4 ) 2 SO 4 , Tween20 0.025 μL, 0.2 μmol MgSO 4 , 20 μmol betaine (Betaine), 0.035 μmol each of the four deoxynucleotides (dNTPs), 0.05 μmol upstream inner primer (FIP), 0.05 μmol downstream inner primer (BIP), 0.006 μmol upstream outer primer (F3), 0.006 μmol Downstream outer primer (B3), 0.03 μmol upstream circular primer (LF), 0.03 μmol downstream circular primer (LB), 16 U of Bst DNA polymerase, 0.2 U of AMV reverse transcriptase, sterile double distilled water.
[0082] 3. Assembly of kit
[0083] Same as Step 3 of Example 1.
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com