Pig muscle quality correlated numerator mark CSRP3 clone and application thereof
A molecular marker and muscle quality technology, applied in the field of livestock genetic engineering, can solve the problem of insufficient number of genes
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0022] Nucleotide sequence cloning of embodiment 1 CSRP3 gene
[0023] 1. cDNA cloning of CSRP3 gene
[0024] (1) Primer design
[0025] Using the reported mRNA sequence of the human CSRP3 gene (GenBank accession number: NM_003476.2) as an information probe, using the BLAST tool in NCBI to screen homologous sequences in the GenBank pig EST database, a series of 90% homology was obtained The above ESTs (fragment length greater than 100bp), using the SeqMan program in DNAStar software to construct the porcine CSRP3 gene EST-contig, based on which the 5'RACE outer primer P-5O, 5'RACE inner primer P-5I, 3' RACE outer primer P-3O and 3'RACE inner primer P-3I, the primer DNA sequences are shown in Table 1:
[0026] Table 1: Design of primer sequences for cDNA cloning of CSRP3 gene
[0027]
[0028] (2) RACE amplification
[0029] Referring to the instructions of the TriZoL kit (product of GIBCO, USA), the kit was used to extract total RNA from the muscle tissue of adult landr...
Embodiment 2
[0043] Example 2 Association Analysis of CSRP3 Gene C1924T TaqI PCR-RFLP Genotype and Meat Quality Traits
[0044] 1. Establishment of TaqI PCR-RFLP detection method
[0045] (1) Primer sequence
[0046] CRP3-E4-S: 5′GGTACTGTTCGCCAAGGAGA 3′
[0047] CRP3-E4-R: 5′ TCCAGGAAAGTGGGTGAAGA 3′
[0048] (2) PCR amplification conditions
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com