Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Natural antibacterial agent-recombinant chicken-beta alexin protein Gal-9 preparation method

A natural antibacterial agent, β-defensin technology, applied in the field of biomaterial preparation, can solve the problems of human health and environmental threats, antibiotic residues, etc.

Inactive Publication Date: 2007-08-01
NORTHEAST AGRICULTURAL UNIVERSITY
View PDF0 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0002] Due to the widespread use of antibiotics in feed, antibiotics remain in livestock and livestock products, and cause antibiotic resistance in animals, posing a great threat to human health and the environment

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Natural antibacterial agent-recombinant chicken-beta alexin protein Gal-9 preparation method
  • Natural antibacterial agent-recombinant chicken-beta alexin protein Gal-9 preparation method
  • Natural antibacterial agent-recombinant chicken-beta alexin protein Gal-9 preparation method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0021] The utility model is described in more detail below in conjunction with accompanying drawing example:

[0022] 1. Design specific primers according to the published chicken-beta defensin Gal-9 gene sequence, upstream primer: 5'-GGA TCC CCG GAA TTC ATG CAG ATC CTG CCT CTC-3', downstream primer: 5'-TCA GGA ATA CCA TCG GCT CCG GCA GCA GAA-3`

[0023] 2. The chicken β-defensin Gal-9 gene was amplified from the chicken tongue tissue by RT-PCR and cloned into the PMD-T vector, which was determined to be the chicken-β-defensin Gal-9 gene by sequence determination. (The shaded part is the target gene sequence, the rest is the vector, the primers are in the box, and the start codon and stop codon are in italics):

[0024]

[0025]

[0026]

[0027]

[0028]

[0029] AAGCTTGGGA

[0030] ATCTCTAAGGATCCCCGGGTACCGAGCTCGAATTCGTAATCAT

[0031] GGTCATAGCTGTTTCCTGTGTGAAATTGTTATTCCCGCTCACAA

[0032] TTCCACACAACATACC

[0033] 3. Construction of prokaryotic expression...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for preparing natural antibiotics- recombined chicken- beta Buchner's bodies Gal-9. The invention employs molecular biology technology to clone chicken- beta Buchner's bodies Gal-9 gene from chicken, and expresses chicken- beta Buchner's bodies Gal-9 protein outside chicken body by using proper expression host. It is found by further research that the chicken- beta Buchner's bodies Gal-9 possesses wide anti bacteria activity and immunologic enhancement. The recombined chicken- beta Buchner's bodies Gal-9 is characterized in that: (1) ir can inhibit and kill bacillus coli, salmonella, Micrococcus pyogenes and so on, (2) prevents avian infectious brunchitis virus, (3) increases antibody for avian infectious brunchitis virus concentration by 10- 20 % in dimefox after oral administration for one week by chicken, improves apleen lymphocyte blastogenesis by 40- 50%.

Description

1. Technical field [0001] The invention relates to a preparation method of a biological material, in particular to a preparation method of a biological material with broad-spectrum antibacterial activity and immune promotion effect. 2. Background technology [0002] Due to the widespread use of antibiotics in feed, the antibiotics remain in the carcasses and livestock products, and cause antibiotic resistance in animals, posing a great threat to human health and the environment. Therefore there is an urgent need for a natural pollution-free feed additive to be used in feed to promote animal growth and reduce feeding costs. Recombinant chicken-beta defensin protein (gallinacins) Gal-9 is a small molecule polypeptide that naturally exists in chickens, contains 67 amino acid residues, and has broad-spectrum antibacterial activity. It has broad-spectrum antibacterial activity and immune promoting effect in vivo and in vitro, which provides a theoretical basis for the research a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/12C12N1/21
Inventor 马得莹
Owner NORTHEAST AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com