Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Gene of encoded photosensitive chromoprotein for preventing and controlling crop disease

A phytochrome, plant disease technology, applied in the field of target application, gene encoding phytochrome protein, can solve problems such as aggravating environmental pollution, drug residues, and increasing agricultural costs

Inactive Publication Date: 2008-08-06
GUANGXI UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

With the enhancement of pathogenic bacteria's resistance to drugs, the amount of pesticides is increasing, which not only aggravates environmental pollution and drug residues, but also greatly increases agricultural costs. Therefore, it is urgent to develop new strategies for disease prevention and treatment and new pollution-free drugs

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene of encoded photosensitive chromoprotein for preventing and controlling crop disease
  • Gene of encoded photosensitive chromoprotein for preventing and controlling crop disease
  • Gene of encoded photosensitive chromoprotein for preventing and controlling crop disease

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Embodiment 1 Construction of Xanthomonas mutant library of cabbage black rot

[0025] Tn5gusA5 (Sharma, 1991) was introduced into Xcc wild-type strain 8004 using the shuttle plasmid pLAFR1 between E. Xcc::Tn5gusA5 insertion mutants were screened with resistance markers of Xcc, combined with the whole genome sequence of Xcc (genome sequence number NC_007086) and TAIL-PCR (Thermal Asymetric Interlaced-PCR) technology (Yao-Guang Liu, 1995), it was determined that Tn5gusA5 was in The insertion position on the genome, and PCR verification was performed on the insertion position. By investigating the phenotypic changes such as pathogenicity, extracellular enzyme activity, and extracellular polysaccharide synthesis of mutants, the pathogenicity-related genes are screened (Tang et al, 2005). The present invention relates to one of the new pathogenicity-related genes -- XC4241 gene (phytochrome-like protein gene), its insertion mutant number is 064H01, and the screening process...

Embodiment 2

[0026] Example 2 Cloning and sequence determination of XC4241 gene (phytochrome-like protein gene)

[0027] According to the gene sequence of XC4241 (see sequence listing, base 1 to base 2305), design primers (upstream primer GGGAATTC CGATGCCGCCGTGCCGCCGCCG and downstream primer GGTCTAGA GTCATGCCGATCCCGAGCACCG; PCR conditions 95°C for 3min; 95°C for 30sec, 60°C for 30sec, 72°C 2.5min, 30 cycles; 72°C for 5min), using the total DNA of Xanthomonas cabbage black rot strain 8004 as a template, amplify the full-length sequence of the gene by PCR, and clone it into the cloning vector pGEM3Zf(+) In this method, the DNA nucleotide sequence (SEQ ID No.1) was determined on an ABI377 DNA automatic sequencer by the dideoxynucleotide method. The correct XC4241 gene sequence verified by sequencing was cloned into the shuttle vector pLAFRJ, and the recombinant plasmid pCXC4241 containing the gene was obtained. The plasmid was digested with EcoRI and XbaI, and besides a 22kb vector band, the...

Embodiment 3

[0028] Example 3 Verification of XC4241 Gene Insertion Mutant 064H01

[0029] The insertion mutant 064H01 was sequenced and located by TAIL-PCR, and it was found that it was inserted into the XC4241 gene. Using a primer on the IS50R side of the transposon Tn5

[0030] (CCGCCGAAGAGAACACAGATTTA) and a primer for the upstream gene XC4242 (GenBank accession number YP_245300)

[0031] (5'-CCACATCGACGCCGATACCTACG-3') paired for PCR verification (95°C 3min; 95°C 30sec, 60°C 30sec, 72°C 45sec, 30 cycles; 72°C 5min), the expected size of the product is 676 bp (see figure 2 ).

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses a phathopoiesis related gene (photosensitive pigment-protein gene) from Xanthomonas causing cabbage black rot. The photosensitive pigment-protein gene provided by the invention contains one of the following nucleotide sequences: 1) DNA sequence shown in SEQ ID No.1, 2) DNA sequence containing over 80% homology with DNA sequence shown in SEQ ID No. 1. The invention also involves the application of the genes in plant disease prevention and cure, as well as the application for drug target in plant disease prevention and cure.

Description

technical field [0001] The invention relates to the field of plant disease prevention and control, more specifically, the invention relates to a gene encoding phytochrome-like protein for preventing and controlling crop diseases. The present invention also relates to the application of the gene in plant disease control and as the target of medicine for plant disease control. Background technique [0002] Plant diseases have always been one of the main factors that reduce crop yield and quality. With the enhancement of pathogenic bacteria's resistance to drugs, the amount of pesticides is increasing, which not only aggravates environmental pollution and drug residues, but also greatly increases agricultural costs. Therefore, it is urgent to develop new strategies for disease prevention and treatment and new pollution-free drugs . Understanding the genetic mechanism of plant pathogens infecting hosts is the key to developing new drugs and disease control strategies. [0003...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/31C12N15/63C12N15/82
Inventor 姜伯乐唐纪良何勇强唐东阶姜伟韦红玉臧宁韦珂张穗生
Owner GUANGXI UNIV
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More