Supercharge Your Innovation With Domain-Expert AI Agents!

Acetolactate decarboxylase

a technology of acetolactate and decarboxylase, which is applied in the direction of lyases, enzyme stabilisation, carbon-carbon lyases, etc., can solve the problems of negative effect on beer flavor and taste, formation of diacetyl, and unstable aldc at fermenting conditions, so as to increase the activity and/or stability of an aldc enzym

Inactive Publication Date: 2018-06-21
DUPONT NUTRITION BIOSCIENCES APS
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

The patent describes methods for increasing the activity and stability of an enzyme called ALDC in a fermentation system. This is achieved by adding zinc to the fermentation system during the fermentation process of a beverage, such as beer, wine, cider, perry, or sake. The technical effect of this is to improve the quality and taste of the beverage, resulting in a more robust and consistent fermentation process.

Problems solved by technology

Formation of diacetyl is most disadvantageous because of its strong and unpleasant smell and in case of beer even small amounts of diacetyl of about 0.10 to 0.15 mg / liter has a negative effect on the flavor and taste of the beer.
However, ALDC can be unstable at fermenting conditions, especially those of fermenting worts with low malt content.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Acetolactate decarboxylase
  • Acetolactate decarboxylase
  • Acetolactate decarboxylase

Examples

Experimental program
Comparison scheme
Effect test

example 1

ous Expression of Acetolactate Decarboxylase, aldB

[0183]The Brevibacillus brevis (which may be referred to as Bacillus brevis) acetolactate decarboxylases (ALDC) aldB gene was previously identified (Diderichsen et al., J Bacteriol. (1990) 172(8): 4315), with the sequence set forth as UNIPROT Accession No. P23616.1. The sequence of this gene, aldB, is depicted in SEQ ID NO:1. The nucleotides highlighted in bold and underlined are the nucleotides which encode the signal peptide.

sets forth the nucleotide sequence of the aldBgene:SEQ ID NO: 1gctgtctttgactgcttttgcagctacaacggctactgtaccagcaccacctgccaagcaggaatccaaacctgcggttgccgctaatccggcaccaaaaaatgtactgtttcaatactcaacgatcaatgcactcatgcttggacagtttgaaggggacttgactttgaaagacctgaagctgcgaggcgatatggggcttggtaccatcaatgatctcgatggagagatgattcagatgggtacaaaattctaccagatcgacagcaccggaaaattatcggagctgccagaaagtgtgaaaactccatttgcggttactacacatttcgagccgaaagaaaaaactacattaaccaatgtgcaagattacaatcaattaacaaaaatgcttgaggagaaatttgaaaacaagaacgtcttttatgccgtaaagctgaccggtacctttaa...

example 2

etermination Methods

Protein Determination by Stain Free Imager Criterion

[0192]Protein was quantified by SDS-PAGE gel and densitometry using Gel Doc™ EZ imaging system. Reagents used in the assay: Concentrated (2×) Laemmli Sample Buffer (Bio-Rad, Catalogue #161-0737); 26-well XT 4-12% Bis-Tris Gel (Bio-Rad, Catalogue #345-0125); protein markers “Precision Plus Protein Standards” (Bio-Rad, Catalogue #161-0363); protein standard BSA (Thermo Scientific, Catalogue #23208) and SimplyBlue Safestain (Invitrogen, Catalogue #LC 6060. The assay was carried out as follow: In a 96well-PCR plate 504, diluted enzyme sample were mixed with 50 μL sample buffer containing 2.7 mg DTT. The plate was sealed by Microseal ‘B’ Film from Bio-Rad and was placed into PCR machine to be heated to 70° C. for 10 minutes. After that the chamber was filled by running buffer, gel cassette was set. Then 10 μL of each sample and standard (0.125-1.00 mg / mL BSA) was loaded on the gel and 5 μL of the markers were loaded....

example 3

Assay Method

Spectrophotometric Assay of α-Acetolactate Decarboxylase

[0193]α-Acetolactate decarboxylase (ALDC) catalyses the decarboxylation of α-acetolactate to acetoin. The reaction product acetoin can be quantified colourimetrically. Acetoin mixed with α-naphtol and creatine forms a characteristic red color absorbing at OD522 nm. ALDC activity was calculated based on OD522 nm and an acetoin calibration curve. The assay was carried out as follows: 20 mM acetolactate substrate was prepared by mixing 100 μL ethyl-2-acetoxy-2-methylacetoacetate (Sigma, Catalogue#220396) with 3.6 mL 0.5 M NaOH at 10° C. for 10 min. 20 mL 50 mM MES pH 6.0 was added, pH was adjusted to pH 6.0 and volume adjusted to 25 mL with 50 mM MES pH 6.0. 80 μL 20 mM acetolactate substrate was mixed with 20 μL enzyme sample diluted in 50 mM MES, pH 6.0, 0.6 M NaCl, 0.05% BRIJ 35 and 0.01% BSA. The substrate / enzyme mixture was incubated at 30° C. for 10 min. Then 16 μL substrate / enzyme mixture was transferred to 200 ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
concentrationaaaaaaaaaa
concentrationaaaaaaaaaa
atomic radiusaaaaaaaaaa
Login to View More

Abstract

The present disclosure provides methods, compositions, apparatuses and kits comprising ALDC enzymes having a better stability and / or activity, and, optionally, the yield of ALDC enzymes which can be recovered from microorganisms is improved. In some embodiments, the present disclosure provides methods, apparatuses, compositions and kits for the use of metal ions to increase stability and / or activity, and which further can be used to recover the enzymes from microorganisms in improved yields.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS[0001]This applications claims priority to and the benefit of United States provisional patent application No. 62 / 165,671, filed May 22, 2015; 62 / 166,610, filed May 26, 2015; and 62 / 168,406, filed May 29, 2015; each provisional application titled “ALDC”.INCORPORATION BY REFERENCE OF THE SEQUENCE LISTING[0002]The sequence listing provided in the file named “20160505_NB40736_PCT_SEQS_ST25.txt” with a size of 16,666 bytes which was created on May 5, 2016 and which is filed herewith, is incorporated by reference herein in its entirety.BACKGROUND[0003]Diacetyl is sometimes an unwanted by-product of fermentation processes of carbohydrate containing substances, e.g. wort or grape juice. Formation of diacetyl is most disadvantageous because of its strong and unpleasant smell and in case of beer even small amounts of diacetyl of about 0.10 to 0.15 mg / liter has a negative effect on the flavor and taste of the beer. During the maturation of beer, diacetyl...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(United States)
IPC IPC(8): C12N9/96C12N1/38C12N9/88C12C5/00C12G1/022
CPCC12N9/96C12N1/38C12N9/88C12C5/004C12G1/0203C12G2200/15C12Y401/01005C12C5/00Y02E50/10
Inventor CRAMER, JACOB FLYVHOLMJENSEN, LENE BOJSENKELLETT-SMITH, ANJA HEMMINGSENBLADT, TOVELEE, SANG-KYU
Owner DUPONT NUTRITION BIOSCIENCES APS
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More