Diagnostic tests for a new spirochete, Borrelia lonestari sp. nov.
a technology of borrelia lonestari and diagnostic tests, applied in the field of infection and disease, can solve the problems of no means of identification of the new spirochete, no means of diagnosis of infection, no compositions for clinical tests, laboratory assays, etc., and achieve the effect of preventing protease digestion
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Benefits of technology
Problems solved by technology
Method used
Image
Examples
example 1
Evidence for a Spirochete in A. americanum that Cross-Reacts with Anti-B. burgdorfei Antiserum
[0118] The present example provides evidence for a spirochete in A. americanum that cross-reacts with anti-B. Burgdorfei antiserum at high concentrations of the antiserum.
[0119] For the present study, A. americanum ticks were collected from field locations in Missouri, New Jersey, New York, North Carolina, and Texas and examined with anti-B. burgdorferi polyclonal antisera in concentrations giving cross-reactions with other Borrelia spp. (Maupin et al., 1991). Fluorescent photomicrographs were taken of B. turicatae, a relapsing fever agent, and spirochetes in the crushed midgut of an A. americanum tick stained with a 1:10 dilution of fluorescein isothiocyanate-conjugated rabbit antibodies to B. burgdorferi (Maupin et al., 1991). Approximately 2% of the ticks, both nymphs and adults, in Missouri, New Jersey, New York, and North Carolina contained immunoreactive spirochetes of between 10 an...
example 2
The A. americanum Spirochete is a New Borrelia Species, B. lonestari sp. Nov.
[0121] The present example describes the inventors' analysis of the A. americanum spirochete that led to their determination that the spirochete is a new Borrelia species.
[0122] The present inventors used the polymerase chain reaction (PCR™) and amplification of conserved genes using primers designed on the basis of sequences of possibly-related organisms (Relman, 1993). The genes for 16S rRNA and flagellin, the major structural protein of flagella, of several Borrelia spp. were available, and alignment revealed regions of genus-specific sequences.
[0123]A. americanum ticks were collected in New Jersey and New York from the field by flagging. Flagging is a technique described in Maupin et al., (1991) which reference is specifically incorporated herein by reference. A. americanum ticks from Texas had been removed from human hosts and submitted to the Department of Health. Ticks were dissected with sterile ...
example 3
Regions of B. lonestari sp. Nov. Flagellin Gene and rRNA Gene Sequences Differ from Those of Other Borrelia sp.
[0129] The present example describes those regions of the B. lonestari sp. nov. flagellin amino acid and rRNA sequences that differ from those of other Borrelia sp.
[0130] With the inventors' collection of evidence that the Amblyomma spirochete was a new Borrelia sp., sets of primers were used to amplify a larger region of the flagellin gene and most of the 16S rRNA gene. The primers were based on identical sequences in flagellin and 16S rRNA genes of Borrelia spp. The primers differed in sequence at two or more positions from homologous sequences of other spirochetes and bacteria. In the following primer sequences, the positions listed in parentheses refer to B. burgdorferi flagellin (Fla) and 16S rRNA (16Rna) genes:
FlaLL,SEQ ID NO:115′ACATATTCAGATGCAGACAGAGGT3′ (301-324);FlaRL,SEQ ID NO:123′TGTTAGACGTTACCGTTACTAACG5′ (942-965);16RnaL,SEQ ID NO:135′CTGGCAGTGCGTCTTAAGCA3...
PUM
Property | Measurement | Unit |
---|---|---|
pH | aaaaa | aaaaa |
temperatures | aaaaa | aaaaa |
temperature | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap