Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Relativity of glycerotriphosphate dehydrogenase gene with primary hypertension

A high blood pressure and gene technology, applied in the fields of molecular biology and medicine, can solve the problems of unconfirmed correlation between SNP and essential hypertension, unconfirmed, unconfirmed correlation between GPD2 gene and essential hypertension, etc.

Inactive Publication Date: 2006-11-15
SHANGHAI INST OF HYPERTENSION +1
View PDF0 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The Shanghai Institute of Hypertension has completed the whole gene scan of the Han hypertensive family in Shanghai area, and the study suggests that there is a close linkage between the 2q14-q23 region and hypertension (Zhu DL, Wang HY, Xiong MM, et al. Linkage of hypertension to chromosome 2q14-q23 in Chinese families.J Hypertens 2001;19:55-61), however, it is not determined which gene in this region is the EH susceptibility gene
The GPD2 gene is one of the many candidate genes in this location area, but there is currently no report confirming the correlation between the GPD2 gene and essential hypertension, let alone the report confirming the correlation between the SNP of the GPD2 gene and essential hypertension

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Relativity of glycerotriphosphate dehydrogenase gene with primary hypertension

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0057] 1 Objects and methods

[0058] 1.1 Research object

[0059] 1.1.1 Chinese SNP discovery and confirmation samples

[0060] The sample is 24 primary hypertension patients from 24 core Han nationality hypertensive families who are unrelated.

[0061] 1.1.2 SNP typing and association analysis research sample

[0062] All subjects are of Han nationality. There were 300 patients in the essential hypertension group (EH group) and the normal blood pressure group (NT group), both from Shanghai, China, and they were not related to each other. The EH group were inpatients in the Hypertension Department of Shanghai Ruijin Hospital, all of whom were of Han nationality and were not related. The average age is 57.32±11.75 years. standard constrain:

[0063] The systolic blood pressure is 140mmHg and / or the diastolic blood pressure is 90mmHg, or they are receiving antihypertensive drug treatment for at least one year;

[0064] Except for those with onset before or after the age of 60;

[0...

Embodiment 2

[0097] Susceptibility auxiliary detection kit for essential hypertension

[0098] Prepare a kit containing:

[0099] PCR reaction buffer containing Taq enzyme dNTP magnesium ion PCR reaction buffer

[0100] Name Sequence (5’→3’) Number Concentration

[0101] Forward primer gtagatgcctggctgagaatg SEQ ID NO: 22 Dry powder 20D

[0102] Reverse primer gcgtggcataaatgaaagaga SEQ ID NO: 23 dry powder 20D

[0103] PCR reaction buffer containing Taq enzyme dNTP magnesium ion PCR reaction buffer

[0104] Take 3ml of blood from the male patient to be tested, and use conventional methods (or use a specific kit) to extract DNA from the blood. The PCR primers in the hypertension detection kit are diluted to 1μmol / μl, and the extracted DNA is used as a template to perform a PCR reaction with the provided primers. After the PCR product is purified, use ABI-PRISM TM 377 DNA sequencer performs two-way sequencing with fluorescent labeling terminal termination method, and uses Polyphred software for s...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

This invention discloses a method to check primary hypertension which is easy to infect, it includes the detection of individual glycerol 3-phosphate dehydrogonase's gene (GPD2), whether the transcript or protein is changed as normal lever, if there is difference, it shows that the individual is apt to infect the primary hypertension than the normal. This invention also discloses corresponding measuring reagent box.

Description

Technical field [0001] The present invention relates to the fields of molecular biology and medicine. More specifically, it relates to the single nucleotide polymorphism (singlenucleotide polymorphism, SNP) of human glycerol-3-phosphate dehydrogenase 2 (GPD2) and its correlation with essential hypertension. The present invention also relates to methods and kits for detecting these SNPs. Background technique [0002] Essential hypertension (EH) is the most common cardiovascular disease. Its incidence is increasing year by year, and it can cause serious heart, brain, and kidney complications. It is a major risk factor for stroke and coronary heart disease. EH is a polygenic disease caused by the interaction of genetic and environmental factors. Searching for EH-related genes to clarify the genetic mechanism of hypertension has become a current research hotspot (Harrap SB. Hypertension: genes versus environment. Lancet, 1994, 344: 169-171). [0003] Locational cloning is one of the ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68
Inventor 张怡张奎星朱鼎良高平进王谷亮黄薇
Owner SHANGHAI INST OF HYPERTENSION
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com