Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for reforming high-virulent nuclear polyhedrosis virus of lepidoptera pest

A karyotype polyhedron and lepidopteran technology, applied in the biological field, can solve the problems of limited popularization and application, unsatisfactory control effect, long incubation period and the like

Inactive Publication Date: 2006-07-19
ZHEJIANG UNIV
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the wild-type NPV virus strain has a long incubation period after infection, slow insecticidal speed, and unsatisfactory control effect.
Therefore, the popularization and application of NPV biopesticides in actual production is still relatively limited.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for reforming high-virulent nuclear polyhedrosis virus of lepidoptera pest

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0019] Example NPV construction method containing the tea geometrid chitin synthase (CS) antisense gene sequence:

[0020] 1) Take about 100 mg of 1 third-instar tea geometrid larvae, extract total RNA with Trizol (Invitrogen Company) reagent, detect RNA quality by electrophoresis, and analyze RNA concentration with GENQUENT. Refer to the reagent and instrument instructions for specific operations;

[0021] 2) Synthesize the first strand of cDNA of tea geometrid larvae with the MMLV first strand cDNA synthesis kit, and refer to the kit instructions for specific operations;

[0022] 3) Perform RT-PCR with the following primer pairs containing restriction sites, and the PCR conditions are shown in Table 1;

[0023] L 5'AA TTCGAATACGCCATCGGCCATTGG (The underlined part is the Xba I restriction site)

[0024] R 5'AA CCAACGATCCTCGCCCTGATCGTACTG (the underlined part is the restriction site of BamH I)

[0025] PCR reaction system

PCR reaction conditions

The ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The method to modify wild NPV and construct the new for Lepidoptera pest with anti-sense- genetic technique is presented and comprises the scheme as: (1) cloning CS conservative sequence of geometrid; (2) constructing the transfer carrier for the anti-sense CS gene of Lepidoptera pest; (3) recombining NPV; (4) validating the NPV with PCR or other methods; (5) contrast with wild NPV, evaluating the insect disinfectation capacity of recombined NPV for screening the virus strain with higher virulence and faster diffusion and secondary infection speed.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to a method for transforming wild nuclear polyhedrosis virus (NPV) by antisense gene technology and constructing a novel NPV of lepidopteran pests. Background technique [0002] Lepidoptera insects, such as inchworms and caterpillars, are one of the important pest species that damage crops. When these pests occur in large numbers, they cause severe crop yield and quality deterioration. Therefore, Lepidoptera insects such as inchworms are one of the important control objects in crop production. At present, there are two main types of pesticides used in production: one is chemically synthesized pesticides, such as pyrethroid pesticides, organophosphorus pesticides and diflubenzuron, etc.; the other is biological pesticides, such as nuclear polyhedrosis virus (NPV) preparations , Bacillus thuringiensis (Bt) preparations and some predatory insects, etc. Chemically synthesized pesticides ha...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N7/01C12N15/63C12N15/66C12Q1/68A01N63/00
Inventor 陆建良林晨梁月荣张广辉杜颖颖叶俭惠
Owner ZHEJIANG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products