Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Indirect method of enzyme-linked immunosorbent assay for diagnosing antibody of hog cholera

A swine fever antibody and swine fever virus technology, which is applied in measurement devices, instruments, scientific instruments, etc., can solve the problems of difficulty in meeting swine fever diagnosis and immune detection, limited production of swine fever antigens, and high cost, and achieves low cost and production. The effect of short cycle and short time-consuming

Inactive Publication Date: 2004-10-27
LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
View PDF0 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Laboratories can choose different methods to detect antibodies according to their needs. Among them, the serological diagnosis of classical swine fever virus antibody is an important tool for the diagnosis of classical swine fever and the main method for detecting the antibody level of immune pigs. The most commonly used method is ELISA detection method, but currently The antigen used in ELISA detection is cell-cultured virus, and the concentration of CSF virus in cell culture is low, resulting in limited yield and high cost of CSF antigen produced by this method, which is difficult to meet the needs of domestic CSF diagnosis and immune detection.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Indirect method of enzyme-linked immunosorbent assay for diagnosing antibody of hog cholera

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0010] a) Extraction of viral RNA:

[0011] Rabbit spleen tissue obtained from the China Veterinary Drug Control Institute was used to extract the total RNA kit from Boda Company according to the instructions.

[0012] b) reverse transcription:

[0013] Extracted total RNA 12 μL, downstream primer (5′CTGCCAACCGCCGTCTATCTT3′) 1 μL, preheated at 65°C for 10 minutes, ice-bathed for 5 minutes, then added 5 times reverse transcription buffer 4 μL, dNTP 2 μL, AMV 1 μL, total volume 20 μL, 42°C for 1 Hour.

[0014] c) PCR and nPCR amplification of target gene E 2 :

[0015] Take 5 μL of reverse transcription product, 5 μL of 10-fold PCR buffer, MgCl 2 3 μL, 4 μL of dNTP, 1 μL of each primer (upstream primer 5′TGTATTGACCAGACTGG3′, downstream primer 5′CTGCCAACCGCCGTCTATCTT3′), 0.5 μL Taq enzyme, and add water to 50 μL for amplification. The reaction conditions were 95°C, 50s; 48°C, 60s; 72°C, 120s, a total of 35 cycles, 72°C extension for 10min. nPCR (nested PCR): Take 1 μL of t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses the method for detecting antibody by using indirect enzyme-linked immunosorbent assay (ELISA) with recombinant protein being as antigen. The method includes following steps: in E2 gene of structural protein of hog cholera virus, a segment of gene of encoding antigen is connected to carrier of pGEM-T Easy plasmid so as to obtain recombinant plasmid; connecting purified recombinant plasmid to expression vector pPROEX-HTb, and shifting it in bacillus coli; culturing bacillus coli, expression carrier of the said segment of gene is expressed in bacillus coli; after picking up and denaturing the expressed protein by inclusion body, carrying out purifying, renaturing operations. Antibody in sample of hog blood serum is detected by using indirect ELISA under renatured fusion protein being as antigen. Advantages of the method are simple operation, easy of culturing and short production cycle.

Description

technical field [0001] The invention relates to a method for detecting classical swine fever antibody, in particular utilizing prokaryotic expression of structural protein E 2 An indirect enzyme-linked immunosorbent (ELISA) assay for the diagnosis of classical swine fever antibodies. Background technique [0002] Hog Cholera (HC or Classical Swine Fever, CSF) is a highly contagious viral disease of pigs caused by Hog Cholera Virus (HCV), which can cause acute onset of pigs, high fever retention, massive internal bleeding, and death It is a very harmful animal disease, which causes huge economic losses to the pig industry all over the world. Therefore, people pay more attention to the gene structure related to CSFV and the development of CSF vaccine. Studies have shown that the gene structure of the antigenic region of the structural protein E2 of CSFV, in which the outer membrane glycoprotein gp55 encoded by the E2 gene is the main immune antigenic protein, and the antigen...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): G01N33/558G01N33/569G01N33/573
Inventor 刘湘涛谢庆阁魏旭文马军武
Owner LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com