Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

SNP (Single Nucleotide Polymorphism) molecular marker related to egg yield of female pigeons, kit and application of SNP molecular marker

A molecular marker, egg production technology, applied in recombinant DNA technology, microbial determination/inspection, DNA/RNA fragment, etc., can solve the problem of low egg production rate of female pigeons, and improve egg production and production efficiency. , the effect of reducing the cost of feeding

Pending Publication Date: 2022-07-12
JIANGSU INST OF POULTRY SCI
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The main purpose of the present invention is to provide a kind of SNP molecular marker related to the egg production of hens, kit and application thereof for the problem of low egg production rate of hens existing in the prior art

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • SNP (Single Nucleotide Polymorphism) molecular marker related to egg yield of female pigeons, kit and application of SNP molecular marker
  • SNP (Single Nucleotide Polymorphism) molecular marker related to egg yield of female pigeons, kit and application of SNP molecular marker
  • SNP (Single Nucleotide Polymorphism) molecular marker related to egg yield of female pigeons, kit and application of SNP molecular marker

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] The establishment of the allele detection method of embodiment 1 hen egg production

[0025] (1) Collect the venous blood of the same batch of white-feather king pigeons, and extract genomic DNA by phenol-chloroform method. DNA quality and concentration detection, etc. were carried out through standard procedures, and finally qualified DNA samples with an OD260 / 280 ratio between 1.8 and 2.0 were selected for subsequent experiments.

[0026] (2) Amplify the target fragment of the SNP marker site on the exon of the GnIH gene, and the upstream and downstream primers for sequence amplification are:

[0027] Upstream primer sGnIH-F: ttaaagataatgtcttggaagaaaagc (as shown in SEQ_NO.1)

[0028] Downstream primer sGnIH-R: cctgaacatcttgaggcaga (as shown in SEQ_NO.2)

[0029] (3) PCR amplification:

[0030] The reagents used in this example were from Nanjing Novizan Company, the primers were ordered from Shanghai Invitrogen Company, and the sequencing was completed by Shanghai ...

Embodiment 2

[0042] Example 2 Effect analysis of molecular marker sGnIH_c353 mutation

[0043] A SNP molecular marker for improving egg production of female pigeons provided by the present invention, the annual egg production of CC and GC genotype individuals is more, and the annual egg production of GG genotype individuals is less, such as image 3 Therefore, in the early breeding process of hens, individuals with CC and GC genotypes were selected, and individuals with GG genotype were eliminated.

[0044] Using the GnIH gene molecular marker related to pigeon reproduction of the present invention to carry out molecular marker-assisted selection can effectively improve the egg production of hens; the present invention also provides the sequence of the SNP molecular marker and an identification method thereof. And primers, using direct sequencing technology to establish a fast and efficient molecular marker-assisted breeding technology, improve hen egg production, and can carry out early s...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an SNP (Single Nucleotide Polymorphism) molecular marker related to the egg yield of a female pigeon, the SNP molecular marker is positioned at a 212bp position on a second exon of a GnIH gene of the female pigeon, and a basic group at the 212bp position on the second exon of the GnIH gene is G or C; the invention further provides application of a reagent of the SNP molecular marker in preparation of a kit for identifying the egg yield character of the female pigeon to be detected and the kit for identifying the egg yield character of the female pigeon, and finally provides a method for breeding the female pigeon with high egg yield. When the GnIH gene molecular marker related to female pigeon breeding is used for molecular marker-assisted selection, the egg yield of female pigeons can be effectively increased.

Description

technical field [0001] The invention belongs to the technical field of molecular markers, and in particular relates to a molecular marker related to the egg production of female pigeons, a kit and applications thereof. Background technique [0002] With the improvement of people's living standards, the pigeon industry is booming, and pigeon eggs have gradually entered the people's dinner plate as a high-end consumer product. The biggest problem faced by the pigeon industry is that the egg production of pigeons is lower than that of other birds. At present, pigeons need to be paired in the production of pigeon eggs, and the egg-laying interval of hens is 8 days or more, and only 2 eggs are laid each time. Greatly restricted the development of the pigeon egg industry. In production, because pigeons are late maturing birds, they usually don't lay eggs until they are 5.5 to 6 months old. Due to their long egg laying interval and their paired production mode, it usually takes a ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6888C12Q1/6869C12Q1/6858C12N15/11
CPCC12Q1/6888C12Q1/6869C12Q1/6858C12Q2600/156C12Q2600/124C12Q2535/101C12Q2531/113C12Q2565/125
Inventor 张蕊卜柱汤青萍穆春宇杨明军常玲玲付胜勇沈欣悦杨小明
Owner JIANGSU INST OF POULTRY SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com