SNP (Single Nucleotide Polymorphism) molecular marker related to egg yield of female pigeons, kit and application of SNP molecular marker
A molecular marker, egg production technology, applied in recombinant DNA technology, microbial determination/inspection, DNA/RNA fragment, etc., can solve the problem of low egg production rate of female pigeons, and improve egg production and production efficiency. , the effect of reducing the cost of feeding
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0024] The establishment of the allele detection method of embodiment 1 hen egg production
[0025] (1) Collect the venous blood of the same batch of white-feather king pigeons, and extract genomic DNA by phenol-chloroform method. DNA quality and concentration detection, etc. were carried out through standard procedures, and finally qualified DNA samples with an OD260 / 280 ratio between 1.8 and 2.0 were selected for subsequent experiments.
[0026] (2) Amplify the target fragment of the SNP marker site on the exon of the GnIH gene, and the upstream and downstream primers for sequence amplification are:
[0027] Upstream primer sGnIH-F: ttaaagataatgtcttggaagaaaagc (as shown in SEQ_NO.1)
[0028] Downstream primer sGnIH-R: cctgaacatcttgaggcaga (as shown in SEQ_NO.2)
[0029] (3) PCR amplification:
[0030] The reagents used in this example were from Nanjing Novizan Company, the primers were ordered from Shanghai Invitrogen Company, and the sequencing was completed by Shanghai ...
Embodiment 2
[0042] Example 2 Effect analysis of molecular marker sGnIH_c353 mutation
[0043] A SNP molecular marker for improving egg production of female pigeons provided by the present invention, the annual egg production of CC and GC genotype individuals is more, and the annual egg production of GG genotype individuals is less, such as image 3 Therefore, in the early breeding process of hens, individuals with CC and GC genotypes were selected, and individuals with GG genotype were eliminated.
[0044] Using the GnIH gene molecular marker related to pigeon reproduction of the present invention to carry out molecular marker-assisted selection can effectively improve the egg production of hens; the present invention also provides the sequence of the SNP molecular marker and an identification method thereof. And primers, using direct sequencing technology to establish a fast and efficient molecular marker-assisted breeding technology, improve hen egg production, and can carry out early s...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com