Method and kit for detecting polymorphism of multiple single nucleotides and application thereof
A single nucleotide polymorphism and multiplex technology, applied in biochemical equipment and methods, microbiological determination/inspection, DNA/RNA fragments, etc., can solve the problem of limiting gene locus detection throughput and inconsistent copy number of single-stranded products , Inconsistent amplification efficiency and other issues, to achieve the effect of reducing reagent cost and detection cost, clear interpretation, and short detection time
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0052] This embodiment provides a method for detecting multiple single nucleotide polymorphisms, which is suitable for gene detection of individualized medications for chronic cardiovascular diseases such as hypertension, hyperglycemia, hyperlipidemia, warfarin, and clopidogrel, As well as fields with multiple single nucleotide polymorphism detection requirements such as tumor drug gene detection, deafness gene detection, and folic acid gene detection, the principle is as follows: figure 1 , figure 2 shown, including the following steps:
[0053] S1: According to the sequence of the target gene locus, design the specific upstream primer, downstream primer and probe sequence of each target gene locus; the probe sequence includes two adjacent single-labeled probes, that is, a 3' end labeled quencher The long probe P1 of the group, and the short probe P2 that is phosphorylated and blocked at the 3' end of the other adjacent 5' end of the fluorescent group, and the length of the...
Embodiment 2
[0058] The present embodiment provides a method for detecting hypertension drug-related genes on the basis of embodiment 1, and specifies the technical solution of embodiment 1. The specific steps of the method are as follows:
[0059] Step S1: According to the gene sequence of the five SNP sites of ACE (rs4646994), CYP2D6*10 (rs1065852), ADRB1 (rs1801253), AGTR1 (rs5186) and CYP2C9*3 (rs1057910), use MEGA4 software to perform sequence clastal W method comparison Yes, with the assistance of primer design software Primer Premier 5 and probe design software Primer Express3.0, specific detection primers and probe sets were designed. The relevant specific sequences are as follows:
[0060] Primer sequence:
[0061] ACEF1:TTTCTCTAGACCTGCTGCCTATAC,
[0062] ACER1:AGCTCAGAGAATTTCAGAGCTG,
[0063] CYP2D6*10F1: CCTCCCTCACCTGGTCGAAGC,
[0064] CYP2D6*10R1: TTCCTGCTCCTGGTGGACCTG,
[0065] ADRB1F1: GCCTTCAACCCCATCATCT,
[0066] ADRB1R1:GTCGTCGTCGTCGTCCGA,
[0067] AGTR1F1: TGAGTGACA...
Embodiment 3
[0102] This embodiment provides a kit for detecting multiple single nucleotide polymorphisms, namely human CYP2D6*10, CYP2C9*3, ADRB1(1165G>C), AGTR1(1166A>C), ACE(I / D) Detection kit (PCR-melting curve method), used for the detection of polymorphisms related to hypertension medication, including CYP2C9*3(rs1057910), AGTR1(rs180 1253), ACE(rs4646994), CYP2D6*10(rs1065852), ADRB1 (rs1801253) 5-fold PCR reaction solution, negative quality control product, positive quality control product, and contains 5 sets of primer-probe combinations in the following 1) to 5):
[0103] 1) Primers SEQ ID NO.1 to SEQ ID NO.2 and probe sequences SEQ ID NO.11 to SEQ ID NO.12 for detecting ACE (rs4646994), wherein the 3' end of the probe shown in SEQ ID NO.11 is labeled BHQ3, the 5' end of the probe shown in SEQ ID NO.12 is labeled with CY5, and the 3' end is phosphorylated;
[0104] 2) The primers SEQ ID NO.3 to SEQ ID NO.4 and the probe sequences SEQ ID NO.13 to SEQ ID NO.14 for detecting CYP2D6...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com