Method for constructing and applying ep400 gene knockout zebrafish heart failure model
A gene knockout and heart failure technology, applied in the field of construction of ep400 gene knockout zebrafish heart failure model
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] 1) Design CRISPR / Cas9 gene knockout target sites and detection primers respectively
[0036] Query Zebrafish at the National Center for Biotechnology Information (NCBI) ep400 Genomic DNA sequence of the gene, designed on the website The ZiFiT Targeter (http: / / zifit.partners.org / ZiFiT / ) according to the principle of CRISPR / Cas9 knockout ep400 The targeting site of the gene (one targeting site is selected in the region of exon 11 and exon 12 each);
[0037] Specific target site PCR primers are as follows:
[0038] F1 (forward primer)
[0039] tgtaatacgactcactataggacctcgctgtcagatgtgggttttagagctagaaatagc
[0040] F2 (forward primer)
[0041] tgtaatacgactcactataggtacaatagaagagcagggttttagagctagaaatagc
[0042] R (reverse primer): aagcaccgactcggtgccact
[0043] PCR detection primers:
[0044] F (5'-gcttgcctctggaaattctgct-3')
[0045] R (5'-tcgaagccctcagcgtaagcc-3')
[0046] 2) In vitro synthesis of specific gRNA
[0047] a, with BsaI restriction enzyme p 42250 lineari...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap