Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for detecting H7 subtype avian influenza virus without amplification based on Cas13a

A bird flu virus, real-time detection technology, applied in the direction of biochemical equipment and methods, measuring devices, microbial measurement/inspection, etc., can solve the problems of increasing detection time and cost, and achieve the effect of shortening the reaction time and easy operation of the method

Pending Publication Date: 2022-05-10
CHINESE ACAD OF INSPECTION & QUARANTINE
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the traditional PCR reaction has a certain dependence on temperature, and requires precise temperature cycle change equipment as a technical guarantee, which not only increases the detection time, but also increases the cost of detection.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for detecting H7 subtype avian influenza virus without amplification based on Cas13a
  • Method for detecting H7 subtype avian influenza virus without amplification based on Cas13a
  • Method for detecting H7 subtype avian influenza virus without amplification based on Cas13a

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0027] The instruments and reagents used in this embodiment are as follows:

[0028] instrument:

[0029] Bio-Rad real-time fluorescent quantitative PCR instrument (Chromo4 Real-Time PCR Detector).

[0030] Reagent:

[0031] CRISPR-Cas13a (Lwa) gene editing protein, fluorescent double-labeled probe for Cas13a detection system, H7 template ssRNA and H7-specific crRNA, viral genomic DNA / RNA extraction kit.

[0032] Wherein, the H7-specific crRNA nucleic acid sequence is:

[0033] GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACCAUCACACUUGUGAAAUAUUUCAAAGCA.

[0034] Reaction buffer: 10mM Tris-HCl (pH 8.3), 50mM KCl, 1.5mM MgCl 2 .

[0035] The method for directly detecting H7 subtype avian influenza virus without amplification based on CRISPR-Cas13a comprises the following steps:

[0036] (1) Extract sample RNA

[0037] Use the Viral Genomic DNA / RNA Extraction Kit to extract the viral genomic RNA in the sample according to the procedure, and directly detect it, or store it at -80 degr...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for directly detecting H7 subtype avian influenza virus without amplification based on CRISPR-Cas13a. The method comprises the following steps: (1) extracting RNA (Ribonucleic Acid) of a sample; (2) preparing a CRISPR-Cas13a detection and analysis system; (3) adding RNA (Ribonucleic Acid) of a sample to be detected into a detection and analysis system; and (4) reacting for 30-60 minutes under the isothermal condition of 37 DEG C, and detecting a fluorescence signal released by the CRISPR-Cas13a in an attached cleavage manner in real time. The invention discloses a method for directly and rapidly detecting RNA (Ribonucleic Acid) of an H7 subtype avian influenza virus by utilizing a CRISPR-Cas13a (Clustered Regularly Interspaced Short Palindromic Repeats-Cas13a) detection system without pre-amplification of a viral genome. Compared with the conventional CRISPR detection method, the method disclosed by the invention is good in sensitivity, strong in specificity and simpler and more convenient to operate, the reaction time is greatly shortened, and rapid, accurate and low-cost screening can be carried out on the H7 subtype avian influenza virus.

Description

[0001] The invention relates to a set of real-time detection methods for rapid virus detection, in particular to a set of methods for direct detection of H7 subtype avian influenza virus without amplification based on CRISPR-Cas13a, belonging to the field of detection of H7 subtype avian influenza virus. Background technique [0002] Avian influenza (Avian influenza) is an acute, febrile and septic infectious disease of poultry caused by influenza A virus, which belongs to the legal category of infectious diseases. According to the different pathogenicity of avian influenza virus (AIV) to poultry, AIV can be divided into low pathogenic avian influenza virus (LPAIV) and highly pathogenic avian influenza virus (HPAIV). Highly pathogenic avian influenza is highly lethal to poultry and is a severe infectious disease that seriously endangers the poultry industry. The disease is very easy to spread among poultry, which can cause a large number of poultry deaths, bring immeasurable d...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/44G01N21/64
CPCC12Q1/701C12Q1/44G01N21/6428
Inventor 殷宏邹明强王玉峰
Owner CHINESE ACAD OF INSPECTION & QUARANTINE
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More