Simplex methylmalonic acidmia gene mutation detection primer pair and kit
A technology for methylmalonic acidemia and detection kits, which can be used in biochemical equipment and methods, microbial determination/inspection, DNA/RNA fragments, etc., can solve the problem of inability to meet the needs of disease typing and the difficulty of clinical promotion , high technical requirements, to achieve the effect of simple operation, high clinical promotion and good repeatability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0017] A simple methylmalonic acidemia gene mutation detection primer pair according to an embodiment of the present invention includes 3 primer pairs for the Mut gene, as shown in Table 1, the 3 primer pairs include the first A primer pair, a second primer pair and a third primer pair, the first primer pair includes a first upstream primer and a first downstream primer, the second primer pair includes a second upstream primer and a second downstream primer, and the third primer pair includes a third primer pair An upstream primer and a third downstream primer, the nucleotide sequences of the three primer pairs are respectively shown in SEQ ID NO.1-SEQ ID NO.6.
[0018] The wild-type sequence of the Mut gene is shown in SEQ ID NO.7.
[0019] Table 1. Mut detection solution sequence
[0020] Primer Sequence (5'-3') SEQ ID NO. Mut–F1 (first primer) GCTCCTATTCCACCCCTCTTCTA 1 Mut-R1 (first primer) GCAGTAACGACAGACATAAATTAGT 2 Mut-F2 (second primer...
Embodiment 2
[0022] A simple methylmalonic acidemia gene mutation detection kit according to an embodiment of the present invention, the kit includes Mut gene detection solution, amplification reaction solution, sequencing detection solution, negative control substance and positive control substance , the kit is stored at -20°C, the specification of the kit: 50 servings / box, and the specific components are shown in Table 2.
[0023] Wherein, the Mut gene detection solution includes 3 primer pairs for the Mut gene, and the nucleotide sequences of the 3 primer pairs are respectively shown in SEQ ID NO.1-SEQ ID NO.6. The amplification reaction liquid comprises Taq DNA polymerase, dNTPs, PCR amplification buffer, Mg 2+ , UNG enzyme and dUTP. The sequencing detection liquid includes sequencing dye, sequencing reaction liquid and deionized formamide. The positive control substance is a plasmid containing mutations at 25 common sites of the Mut gene, and the negative control substance is an unm...
experiment example 1
[0029] Use the self-built enterprise reference product to carry out the performance verification of the kit described in Example 2, and the specific operations are as follows:
[0030] 1. Sample processing
[0031] Enterprise reference products were selected for kit performance verification. All samples were extracted according to the nucleic acid extraction kit (product number: IVD4173), and the obtained DNA samples were stored at 2-8°C; if the samples were not used for a long time, they could be stored at -20°C.
[0032] 2. PCR amplification
[0033] Configure the PCR mixture (45 μL for each reaction) according to Table 3. Aliquot the prepared PCR mixture into 45 μL of each reaction well. Add 5 μL each of the extracted sample DNA, positive control substance, and negative control substance to the corresponding reaction wells, and carry out PCR amplification on the machine.
[0034] Table 3. PCR Mix Components
[0035] components 1 reaction volume Mut det...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com