Human originating promoter for human body cell to express exogenous gene efficiently
A technology of promoters and genes, applied in the field of human-derived promoters
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0023] Example 1 Construction of reporter gene plasmid pHSP90β6.1 containing promoter B6.1
[0024] 1. Construction of plasmid pHSP90β1 containing hsp90β gene 5' upstream fragment (-1102 / +67bp)
[0025] 1.1 Amplification of the 5' upstream fragment (-1102 / +67bp) of the hsp90β gene:
[0026] According to the sequence of the human hsp90β gene published in the literature ( figure 1 ), designed and synthesized a pair that can amplify hsp90β gene core promoter, upstream promoter element, cAMP response element, an atypical heat shock element (HSE, -648 / -734) and part of the first exon fragment Primers P1 and P2, the primer sequences are as follows:
[0027] P1: 5'GC -1102 GAGCTC CGGCTGCCCTGCAC -1083 3' (the underline is the SacI site)
[0028] P2: 5'GC GAATTC +46 GCAACGTAGGCTTGCTTTCCGA +67 3' (underlined is the EcoRI site) using this pair of primers, a DNA fragment of 1.1 kb consistent with expectations was amplified by PCR from the DNA of the human peripheral blood leuko...
Embodiment 2
[0042] Example 2 Determination of B6.1 promoter activity and its comparison with other viral promoter activities
[0043] A. method
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap