Probe, kit and detection method for rapidly detecting nosema bombycis
A microsporidia and detection method technology, which is applied in the field of probes for rapid detection of silkworm microsporidia, can solve the problems of unfavorable and timely prevention and control, and achieve the effects of reducing reagent mixing and sample addition steps, rapid detection, and high sensitivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0041] The present invention will be further described in detail below in conjunction with the embodiments, so that those skilled in the art can implement it with reference to the description.
[0042]
[0043] 1. Synthesis of probes and primers
[0044] Since the length of the probe sequence needs to be between 40-50bp, and the quenching group and the fluorescent group are respectively connected to a pair of thymine nucleotides, the pair of oligo-Ts are separated by 1-5 bases , one of the heterozygous 1-5 bases is replaced by tetrahydrofuran, designed according to the full-length 762bp of the EB1-Probe gene published by GenBank, the probe starts at 216-256bp, a total of 41bp, quencher group and fluorescence The groups are respectively connected at positions 241 and 245, and thymine at position 242 is replaced by tetrahydrofuran to form the desired detection probe (EB1-Probe). The nucleotide sequence of EB1-Probe is: TGAATTGTATTTTCCAGTAGAGAAA / i6FAMdT / [THF]AA / Based on iBHQ1...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com