Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Linkers for characterizing polynucleotides and uses thereof

A technology of polynucleotides and adapters, which is applied in the determination/inspection of microorganisms, DNA/RNA fragments, recombinant DNA technology, etc., can solve the problems of sequencing time length, sequencing speed reduction, and affecting the output of sequencing data, etc., to achieve The effect of avoiding ATP empty consumption and improving sequencing efficiency

Pending Publication Date: 2022-04-01
QITAN TECH LTD CHENGDU
View PDF4 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Existing adapters have ATP empty consumption in practical applications, that is, adapters that have not been sequenced through the holes will also consume a lot of ATP
Due to the reduction of ATP concentration in the sequencing environment, the sequencing speed will be reduced, and the sequencing time will be too short, which will affect the output of sequencing data

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Linkers for characterizing polynucleotides and uses thereof
  • Linkers for characterizing polynucleotides and uses thereof
  • Linkers for characterizing polynucleotides and uses thereof

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0083] The invention provides a preparation method of the complex, comprising:

[0084] S1: binding the Y1 chain containing L'-S to the motor protein, and the binding region is located in the L' chain;

[0085] S2: adding the PNA-R chain comprising the complementary chain L" to obtain the complex, wherein the motor protein is driven to the blocking chain by the PNA-R chain;

[0086] Preferably, the method includes

[0087] S101: make contain D 1 '-L'-S-D 2 'Y1 chain, containing D 1 ” of the Y2 chain and contain D 2 The annealed product of the YB chain of " is combined with the motor protein, and the binding region is located at the L' chain of the annealed product;

[0088] S102: Adding the PNA-R chain containing the complementary chain L" to obtain the complex, wherein the motor protein is driven to the blocking chain by the PNA-R chain.

[0089] polynucleotide

[0090] Polynucleotides such as nucleic acids are macromolecules containing two or more nucleotides. A po...

Embodiment 1

[0152] Example 1: Preparation of a Y adapter-enzyme complex that reduces ATP empty consumption

[0153] SEQ ID NO: 1GCGGAGTCAAACGGTAGAAGTCG

[0154] SEQ ID NO:2TAACGTATTC

[0155] SEQ ID NO:3ACTGCTCATTCGGTCCTGCTGACT

[0156] SEQ ID NO:4CGACTTCTACCGTTTGACTCCGC

[0157] SEQ ID NO:5GTCAGCAGGACCGAATGA

[0158] SEQ ID NO:6GAATACGTTAGCGG, wherein SEQ ID NO:6 consists of PNA

[0159] SEQ ID NO:7GCAGTAGTCCAGCACCGACC

[0160] SEQ ID NO:8

[0161] GTFDDLTEGQKNAFNIVMKAIKEKKHHVTINGPAGTGKTTLTKFIIEALISTGETGIILAAPTHAAKKILSKLSGKEASTIHSILKINPVTYECNVLFEQKEVPDLAKARVLICDEVSMYDRKLFKILLSTIPPWATIIGIGDNKQIRPVDPGENTAYISPFFTHKDFYQCELTEVKRSNAPIIDVATDVRNGKWIYDKVVDGHGVRGFTGDTALRDFMVNYFSIVKSLDDLFENRVMAFTNKSVDKLNSIIRKKIFETDKDFIVGEIIVMQEPLFKTYKIDGKPVSEIIFNNGQLVRIIEAEYTSTFVKARGVPGEYLIRHWDLTVETYGDDEYYREKIKIISSDEELYKFNLFLGKTCETYKNWNKGGKAPWSDFWDAKSQFSKVKALPASTFHKAQGMSVDRAFIYTPCIHYADVELAQQLLYVGVTRGRYDVFYV

[0162] The complex is formed by the hybridization of 4 different strands;

[0163] The first stran...

Embodiment 2

[0176] Embodiment 2: ATPase activity detection

[0177] Firstly, the NADH reaction mixture was prepared, and the reaction mixture was mainly prepared according to Table 1 below. After the preparation was completed, the reaction mixture was turned horizontally at room temperature and incubated for 10 minutes.

[0178] Table 1 Preparation of NADH reaction mixture

[0179]

[0180] After that, add 112.5 μL NADH reaction mixture in 96-well plate, 37.5 μL (20nM) Y adapter-enzyme complex thing (which is Any one of sample 1 and sample 2 after purification in embodiment 1 ), and then put it into a UV-visible spectrophotometer to measure the absorbance value at 380nm, and set the temperature to 34°C; detect 200 cycles, each cycle is 5 minutes. The collected data were drawn into a standard curve and the ATP consumption value was obtained through the slope of the standard curve.

[0181] The result is as image 3 and Table 2 (adding complex 10h). No addition of PNA-R was used...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention provides adapters for characterizing polynucleotides and uses thereof. The adaptor comprises {L-S} n or {S-L} n in the direction from the 5'end to the 3 'end; and the L double strand comprises a polynucleotide chain L'linked to S and a complementary chain L "to the L ', the L' comprising a first segment remote from the blocking chain S, the first segment comprising a modification moiety, and a second segment close to the blocking chain S, the second segment comprising a motor protein binding active region, the active region being blocked by the complementary chain L"; the complementary chain L ''comprises a polymer which can be competitively combined with the motor protein to an L'chain. The invention provides a novel Y-shaped adaptor, and the adaptor can be used for greatly avoiding ATP (adenosine triphosphate) empty consumption in nanopore sequencing and remarkably improving the sequencing efficiency.

Description

technical field [0001] The invention belongs to the field of gene sequencing, and relates to an adapter used in characterizing polynucleotides, and also relates to a method for characterizing polynucleotides using the adapter. Background technique [0002] Nanopore sequencing technology has the characteristics of long read length, direct reading of modification information and parallel analysis of real-time data production. Nucleic acid-related variations such as shearing and RNA editing) and modification information (including but not limited to methylation, acetylation, etc.) have obvious advantages over next-generation sequencing or other sequencing platforms. The platform supports parallel data production and analysis to realize real-time mutation / modification detection and diagnosis, and the portable design makes it have a wide range of application prospects. [0003] After applying a voltage to both sides of the nanopore, when the analyte (such as polynucleotide, poly...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6869C12Q1/6806C12N15/11
CPCC12N15/11C12Q1/6806G01N33/92C12Q1/6869G01N33/487
Inventor 刘先宇常馨
Owner QITAN TECH LTD CHENGDU
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com