Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Cell line with gene YTHDF1 knocked out and construction method thereof

A cell and gene technology, applied in the field of knockout gene YTHDF1 cell line and its construction, can solve the problem of unclear function and achieve the effect of avoiding cell death

Pending Publication Date: 2022-02-25
SUN YAT SEN UNIV
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the role of YTHDF1 in autophagy is still unclear (Jia, R., et al., m 6 A modification suppresses ocular melanoma through modulating HINT2 mRNA translation.MolCancer,2019.18(1):p.161.)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cell line with gene YTHDF1 knocked out and construction method thereof
  • Cell line with gene YTHDF1 knocked out and construction method thereof
  • Cell line with gene YTHDF1 knocked out and construction method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Example 1 Determination of YTHDF1 Gene Knockout Target Site and gRNA

[0036] The 240bp-266bp sequence corresponding to the first exon of the YTHDF1 gene (Gene ID: 54915) coding region was selected as the knockout target site, and multiple gRNAs were designed. The specific sequences are as follows:

[0037] gRNA-1: TACCTGGGTGTCCACGCTGGTGG (SEQ ID NO: 1);

[0038] gRNA-2: CGCTACCTGGGTGTCCACGCTGG;

[0039] gRNA-3: GTAACCCGGCCCCGCTACCTGGG;

[0040] gRNA-4: GGCCACCAGCGTGGACACCCAGG.

Embodiment 2

[0041] Example 2 Construction of gRNA expression vector

[0042] 1. Experimental method

[0043] (1) According to the gRNA designed in Example 1, design the DNA oligos of the synthetic gRNA, specifically cited

[0044] The object sequence is as follows:

[0045] gRNA1-FP: CACCGTACCTGGGTGTCCACGCTGG (SEQ ID NO: 2);

[0046] gRNA1-RP: AAACCCAGCGTGGACACCCAGGTA (SEQ ID NO: 3);

[0047] gRNA2-FP: CACCGCGCTACCTGGGTGTCCACGC;

[0048] gRNA2-RP: AAACGCGTGGACACCCAGGTAGCG;

[0049] gRNA3-FP: CACCGGTAACCCGGCCCCGCTACCT;

[0050] gRNA3-RP: AAACAGGTAGCGGGGCGGGTTAC;

[0051]gRNA4-FP: CACCGGGCCACCAGCGTGGACACCC;

[0052] gRNA4-RP: AAACGGGTGTCCACGCTGGTGGCC.

[0053] (2) The DNA oligos of the 8 gRNAs synthesized above were used ddH 2 O was dissolved and the concentration was adjusted to 100 μM.

[0054] The annealing reaction system is: gRNA1-FP or gRNA2-FP or gRNA3-FP or gRNA4-FP, 4 μL; gRNA1-RP or gRNA2-RP or gRNA3-RP or gRNA4-RP, 4 μL; 10×NEB Buffer, 1 μL; ddH 2 O, 1 μL.

[0055] Th...

Embodiment 3

[0064] Example 3 Construction of YTHDF1 Gene Knockout Cell Line

[0065] 1. Experimental method

[0066] (1) Construction of HeLa-GFP-LC3B cells that can inducibly express Cas9

[0067] build as figure 2 For the Phage-tet-N-3×flag-SpCas9-DEST-UBC-neo1 vector shown, the specific method is: clone the Cas9 sequence on the PX330 vector into the pENTR-D-TOPO vector by enzyme digestion and ligation, and then pass LR reaction The Cas9 sequence was cloned into the pHAGE-Tet-N-3×FLAG-DEST-UBC-neo vector (the nucleotide sequence is shown in SEQ ID NO: 4). That is, the vector expressing Cas9 was obtained, which was named Phage-tet-N-3xflag-SpCas9-DEST-UBC-neo1 (the nucleotide sequence is shown in SEQ ID NO: 5).

[0068] HEK293T cells were seeded into 6-well cell culture plates, and when the cell density reached 70% the next day, the transient transfection experiment could be carried out.

[0069] The specific method of the transient transfection experiment is as follows: Add 1.2 μg ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a cell line with the gene YTHDF1 knocked out and a construction method of the cell line. According to the method, a gRNA with the YTHDF1 gene knocked out is utilized, and a coding sequence of the gRNA is a nucleotide sequence as shown in SEQ ID NO: 1. According to the invention, the gRNA designed in the invention is utilized, the YTHDF1 gene is accurately and efficiently knocked out through the CRISPR / Cas9 system, a YTHDF1 gene knockout type cell capable of real-time regulation and control is effectively constructed, and the risk of cell death caused by the direct knockout of the YTHDF1 gene is avoided. The establishment of the YTHDF1 gene knockout cell further provides an effective cell model for research on cell autophagy.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to a cell line knocking out gene YTHDF1 and a construction method thereof. Background technique [0002] Autophagy is a catabolic mechanism in the body responsible for the degradation and recycling of macromolecules. Under physiological conditions, autophagy can degrade excess cytoplasmic components, abnormal proteins, aging or damaged organelles, and the degradation products are recycled by the body to maintain normal cell homeostasis; in starvation, hypoxia and endoplasmic Under conditions such as net stress, the body relies on autophagy to maintain survival. [0003] Autophagy is an ancient and highly conserved cell protection mechanism, which not only plays an important role in maintaining the homeostasis of organisms, but also participates in the occurrence and development of various diseases. A large number of studies have shown that autophagy dysfunction is clos...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12N15/11C12N15/867C12N5/10C12Q1/02
CPCC12N15/113C12N15/86C07K14/4705C12N5/0693C12N5/0682G01N33/5005C12N2310/20C12N2740/15043C12N2800/107C12N2510/00
Inventor 张曦亚
Owner SUN YAT SEN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com