Supercharge Your Innovation With Domain-Expert AI Agents!

Kit for detecting SARS-CoV-2 coronavirus and special primer and probe thereof

A technology for SARS-CoV-2 and coronavirus, which is applied in the field of detection kits and special primers and probes for SARS-CoV-2 coronavirus, which can solve the problems of strong infectivity and achieve high detection sensitivity and application prospects Wide, easy-to-use effects

Inactive Publication Date: 2021-09-28
HEFEI INSTITUTES OF PHYSICAL SCIENCE - CHINESE ACAD OF SCI +2
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] SARS-COV-2 coronavirus has infected more than hundreds of thousands of people in many countries around the world, and it is still in the trend of outbreak. Although various countries are actively controlling it, due to its strong infectivity, it is still harmful to human health. It is a major potential threat, so establishing a method and tool for rapid, accurate and specific detection of the virus is of great significance to the control of the spread of the epidemic

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit for detecting SARS-CoV-2 coronavirus and special primer and probe thereof
  • Kit for detecting SARS-CoV-2 coronavirus and special primer and probe thereof
  • Kit for detecting SARS-CoV-2 coronavirus and special primer and probe thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Example 1: Primer and probe design

[0033] This embodiment aims to determine that primers and probes that can detect SARS-COV-2 coronavirus quickly by using fluorescent quantitative polymerase amplification technology, the inventor utilizes the surface protein S gene (SEQ ID NO: 1), according to the design principles of primers and probes, design multiple sets of primers and probe combinations, select the following groups 1 and 2 from the various combinations, and the sequence information is as follows:

[0034] Group 1:

[0035] SA-F1: 5'-TGCCTTGGTGATATTGCTGC-3' (SEQ ID NO: 2);

[0036] SA-R1: 5'-GTACCCGCTAACAGTGCAGAA-3' (SEQ ID NO: 3);

[0037] SA-probe1: 5'-FAM-CGGCCTTACTGTTTTGCCACCTTTGC-BHQ-3' (SEQ ID NO: 4);

[0038] The amplified sequences of primers SA-F1 and SA-R1 are:

[0039]5'-TGCCTTGGTGATATTGCTGCTAGAGACCTCATTTGTGCACAAAAGTTTAACGGCCTTACTGTTTTGCCACCTTTGCTCACAGATGAAATGATTGCTCAATACACTTCTGCACTG TTAGCGGGTAC-3' (SEQ ID NO: 5);

[0040] Group 2:

[0041] SA-F2...

Embodiment 2

[0048] Embodiment 2: establish the method for rapidly detecting SARS-COV-2

[0049] This embodiment adopts the primer and probe of group 1 that above-mentioned embodiment 1 obtains and establishes the method for rapid detection SARS-COV-2 coronavirus, specifically comprises the following steps:

[0050] 2.1. Establish a standard curve: Dilute the positive quality control product obtained in the above-mentioned Example 1 according to a 10-fold gradient to obtain the following gradient concentration solution as a SARS-COV-2 standard substance: 1×10 7 copies / μL, 1×10 6 copies / μL, 1×10 5 copies / μL, 1×10 4 copies / μL, 1×10 3 copies / μL, 1×10 2 copies / μL, 1×10 1 copies / μL, with different concentrations of standard products as templates, under the guidance of the primers and probes shown in Group 1 (Example 1), carry out fluorescent quantitative PCR detection, wherein the system of PCR detection uses the One Step PrimeScript of TAKARA company TM RT-PCR Kit, as shown in Table 1 be...

Embodiment 3

[0069] Embodiment 3, the sensitivity of carrying out real-time fluorescent quantitative PCR detection to SARS-COV-2 coronavirus

[0070] figure 1 Middle A and figure 2 Also all show the sensitivity of the detection method that the present invention carries out real-time fluorescent quantitative PCR to SARS-COV-2 coronavirus, it can be seen that the present invention carries out the detection method of real-time fluorescent quantitative PCR to SARS-COV-2 coronavirus and can detect to 1 ×10 1 copies / μl, and the amplification curve is a specific "S" curve, indicating that the primers and probes of the present invention are suitable for combining with SARS-COV-2 coronavirus RNA, and have higher sensitivity.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a kit for detecting an SARS-CoV-2 coronavirus and a special primer and a probe thereof, and belongs to the technical field of biology. The provided kit and the special primer and probe thereof can be used for rapidly detecting the SARS-COV-2 coronavirus, implement rapid qualitative and quantitative detection of a to-be-detected sample, and can play an important role in the detection of the SARS-COV-2 coronavirus and the vaccine production process.

Description

technical field [0001] The invention belongs to the field of biotechnology, in particular to a test kit for detecting SARS-CoV-2 coronavirus and special primers and probes thereof. Background technique [0002] Studies have shown that SARS-CoV-2, like the 2003 "SARS" SARS coronavirus (SARS-CoV) and "Middle East Respiratory Syndrome" MERS coronavirus (MERS-CoV), belongs to the genus Betacoronavirus. Through gene sequence comparison, SARS-COV-2 has about 80% similarity with SARS-CoV and 40% similarity with MERS-CoV. [0003] SARS-COV-2 coronavirus has infected more than hundreds of thousands of people in many countries around the world, and it is still in the trend of outbreak. Although various countries are actively controlling it, due to its strong infectivity, it is still harmful to human health. Therefore, establishing a method and tool for rapid, accurate and specific detection of the virus is of great significance to the control of the spread of the epidemic. Contents...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/6851C12N15/11C12R1/93
CPCC12Q1/701C12Q1/6851C12Q2563/107C12Q2561/113C12Q2531/113C12N15/11C12Q1/70Y02A50/30
Inventor 胡晨王文超孙永俞俊岭何军刘青松任涛陈程王黎陈先涛
Owner HEFEI INSTITUTES OF PHYSICAL SCIENCE - CHINESE ACAD OF SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More