Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

DNAzyme capable of specifically recognizing toxoplasma gondii and having RNA cutting function and kit

A Toxoplasma gondii-specific technology, applied in the direction of recombinant DNA technology, DNA/RNA fragments, microbial determination/inspection, etc., to achieve strong stability, rapid detection and qualitative analysis, and easy artificial synthesis

Active Publication Date: 2021-08-20
WENZHOU MEDICAL UNIV +1
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There is currently no naturally occurring catalytic DNA, which also needs to be isolated from random sequence DNA libraries through the process of in vitro screening (IVS)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • DNAzyme capable of specifically recognizing toxoplasma gondii and having RNA cutting function and kit
  • DNAzyme capable of specifically recognizing toxoplasma gondii and having RNA cutting function and kit
  • DNAzyme capable of specifically recognizing toxoplasma gondii and having RNA cutting function and kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Synthesis of TG1-RFD: 5-GCAGTACGTAAGATATCGCTGGAAGTATGCGTTGTAGCTTAGTTCTTAACCGGATGCGCATTGTAGGCTCATTAAAGTTACGAGCTAGACGGCCGCATGGTTAGCTACACAGGTATAGAFRQGGTTCGATCAAGA-3 'sequence, where F is the fluorophore FAM-labeled dT, R adenine ribonucleotides, Q is DABCYL labeled dT. When the target molecule is present in the system, the FFD RNA target molecule binding enzyme activation function, thereby releasing the quencher, the fluorophore so that fluorescence signal recovery.

[0026]Anti-continent secreted protein ROP was added to the reaction solution containing 100 nm DNAzyme (100 mM hepes pH 7.5, 400 mM NaPES pH 7.5, 400 mM NaCl, 10 mM MgCl2, 0.02% Tween 20) was added to the same concentration of Dnazymes containing DNAZYME induced by Toxisocoprotein ROP. The screening buffer was controlled, and the mixture was incubated for 5 minutes;

[0027] If figure 2 Destrign, when an arckoid secreted protein ROP is added to the reaction mixture containing DNAzyme, the fluorescent signal is gr...

Embodiment 2

[0031] Synthesis of TG1-RFD: 5-GCAGTACGTAAGATATCGCTGGAAGTATGCGTTGTAGCTTAGTTCTTAACCGGATGCGCATTGTAGGCTCATTAAAGTTACGAGCTAGACGGCCGCATGGTTAGCTACACAGGTATAGAFRQGGTTCGATCAAGA-3 'sequence, where F is the fluorophore FITC-labeled dT, R is uracil ribonucleotides, Q is DABCYL labeled dT. When there is a target molecule in the system, the FFD is bonded to the target molecule to activate the RNA enzyme digestion, thereby releasing the quenching group to restore the fluorescent group fluorescent signal.

[0032] The method of detecting a rigid bow in a rigid probe is used, and the steps include:

[0033] (1) THP-1 and normal untraped THP-1 cells infected with Toxoplasma infection, a reaction solution containing 100 nm DNAzyme (screening buffer: 100 mM hepes pH 7.5, 400 mM NaCl, 10 mM mgCl2, 0.02%), respectively. TWEEN 20) Holled for 5 minutes;

[0034] (2) The reaction solution or the hand-held UV analyzer was measured by a fluorescence spectrophotometer, and the fluorescent signal was observed,...

Embodiment 3

[0036] (1) Synthesis of sequence shown in SEQ ID NO: 1, the todium infection of leukemia cells THP-1 and normal unopened THP-1 cells, respectively, a reaction liquid containing 100 nm DNAzyme (screening buffer: 100mm hepes) PH 7.5, 400 mM NaCl, 10 mM mgCl2, 0.02% Tween 20) mixed room temperature for 5 minutes;

[0037] (2) The above-mentioned reaction liquid is added to the colloidal gold test paper strip (TG101, Wenzhou Yousi Medical Technology Co., Ltd.) containing the DNAZYME identified by a rigid bow, and observes the color of the color, if it appears in T Then, the corresponding detection result is positive, such as Figure 5 Indicated. Combined with colloidal gold test paper readers, semi-quantitative analysis and data were uploaded.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses DNAzyme which can specifically recognize toxoplasma gondii and has an RNA cutting function, and a fluorescent molecular probe system and a kit which are constructed by using the DNAzyme, and the sequence of the DNAzyme is shown as SEQ ID No: 1. According to the present invention, the DNA zyme having the RNA enzyme function and specifically recognizing the toxoplasma gondii secretory protein ROP is adopted as the fluorescent molecular probe, so that the toxoplasma gondii can be rapidly detected within a few minutes. In the reaction process, different fluorescence signals are detected and distinguished through different fluorescence channels of a fluorescence spectrophotometer, so that different pathogens are identified.

Description

Technical field [0001] The present invention belongs to the technical field of detection of macromolecules, more particularly, to a T. gondii can specifically recognize DNAzyme RNA having a cutting function, and kits and strips made of colloidal gold. Background technique [0002] Toxoplasma gondii (Toxoplasma gondii) is an obligate parasite inside the cell, opportunistic protozoa, causing humans and animals were suffering from toxoplasmosis (toxoplasmosis). Toxoplasma may invade any organ of the body, which is a good site for the brain, eyes, lymph nodes, heart, lung, liver and muscle, can cause various diseases, especially in poor host immune function, can cause serious consequences. WHO data show that T. gondii infection was distributed worldwide, the world's adult prevalence rate ranging from 10% to 90%. Toxoplasma infection is often asymptomatic, it is estimated that 30 per cent of the world's population suffer from chronic Toxoplasma gondii infection. Although most people i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12Q1/6893C12Q1/6818
CPCC12N15/113C12Q1/6893C12Q1/6818C12N2310/127C12Q2563/107C12Q2521/345C12Q2565/1015
Inventor 吴诗怡周芳燕黄伟杰吕晟泽赵妍李思慧申志发叶盛
Owner WENZHOU MEDICAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com